Central Dogma is the process where genetic information flows from DNA to RNA to protein, controlling cellular functions and body structure.
Definitions [26]
Define the Transfection.
Transfection is the process of inserting a vector into eukaryotic cells.
Definition: Histone Octamer
A structural unit composed of eight histone protein molecules around which DNA is wrapped is called histone octamer.
Definition: Chromatin
The thread-like complex of DNA and proteins present in the nucleus of eukaryotic cells is called chromatin.
Definition: Nucleoid
Nucleoid is the region in prokaryotic cells where DNA is organized and associated with proteins, despite the absence of a true nucleus.
Definition: DNA packaging
The process by which a very long DNA molecule is compactly organised inside the cell nucleus so that it fits within the limited nuclear space and remains functional is called DNA packaging.
Definition: Histones
Positively charged basic proteins rich in lysine and arginine that associate with DNA to help in its packing in eukaryotic cells are called histones.
Definition: Nucleosome
The basic repeating unit of chromatin formed by DNA wrapped around a histone octamer is called nucleosome.
Definition: NHC Proteins
Proteins other than histones that are associated with chromatin and help in higher-order DNA packaging and regulation are called non-histone chromosomal (NHC) proteins.
Definition: Semi-Conservative Replication
Semi-conservative replication is a mode of DNA replication in which each daughter DNA molecule consists of one parental (old) strand and one newly synthesized strand.
Define.
Translation
Translation is the process by which tRNA having anticodon to the codon on the mRNA, supplies amino acids, as per the message on mRNA.
Define the term codon.
A sequence of three adjacent nucleotides in mRNA that codes for one amino acid is known as a codon.
Definition: Central Dogma
Central dogma is the principle that genetic information flows in one direction in a cell, from DNA to RNA to protein.
Definition: Central Dogma
Define Translocation.
The movement of the ribosome from one end of the mRNA to the other end by the distance of one triplet codon during translation is known as translocation.
Define mutation.
A sudden change that occurs in the nucleotide sequence of a gene, causing either a minor or considerable change in the characters of an individual is known as mutation.
Definition: Transcription
The process of synthesising mRNA from the complementary nucleotide sequence of one strand of DNA, in which uracil replaces thymine, is called transcription.
or
The process of copying genetic information from one strand of the DNA into RNA is termed as transcription.
Definition: Genetic Code
Definition: Triplet Codon
A sequence of three nucleotides on mRNA that codes for a specific amino acid is called a triplet codon.
Definition: Translation
Definition: DNA Fingerprinting
The technique of identifying an individual by analyzing the unique DNA sequence present in each person, similar to fingerprints, is called DNA fingerprinting.
Definition: Repressor Protein
A protein that binds to the operator and prevents transcription of structural genes is called a repressor protein.
Definition: Cistron
An individual gene that codes for a single polypeptide chain is called a cistron.
Definition: Polycistronic mRNA
A single mRNA molecule that carries information for more than one cistron is called polycistronic mRNA.
Definition: Operon
A long segment of DNA that contains an operator, promoter and a group of structural genes working together is called an operon.
Definition: Operator
A regulatory DNA sequence that controls transcription by allowing or blocking RNA polymerase binding is called an operator.
Definition: Regulator Gene
A gene that produces the repressor protein is called a regulator gene.
Key Points
Key Points: Deoxyribonucleic Acid (DNA)
- Miescher (1869) isolated a substance from white blood cell nuclei (pus from bandages) and called it nuclein — the first discovery of nucleic acid.
- Nuclein properties — High phosphorus content + acidic nature → renamed nucleic acid.
- Two types of nucleic acids: DNA and RNA.
- Early belief — Scientists thought proteins were the genetic material (large, complex, varied). DNA was wrongly considered simple and unimportant.
- 1928–1952 — Over 25 years, three key experiments proved that DNA (not protein) is the genetic material.
- Role of DNA — It is stable, can replicate accurately, and passes traits to the next generation — making it the true genetic material.
Key Points: Molecular Structure of DNA
1. DNA structure was first studied by Rosalind Franklin (1953); later explained by Watson and Crick, who proposed the double helix model (Nobel Prize, 1962).
2. DNA is a macromolecule made of two complementary strands twisted into a double helix.
3. Each strand is made up of nucleotides, which include phosphate, sugar (pentose), and a nitrogenous base.
4. There are four nitrogenous bases:
- Adenine (A) pairs with Thymine (T) (2 hydrogen bonds)
- Guanine (G) pairs with Cytosine (C) (3 hydrogen bonds)
5. The two strands form a ladder-like structure, with bases as rungs and sugar-phosphate as the backbone.
Key Points: Griffith’s Experiment
- Frederick Griffith (1928), a British medical officer, experimented on Streptococcus pneumoniae to find a cure for pneumonia.
- Two strains were used - S-strain (virulent, smooth, pathogenic, encapsulated) and R-strain (non-virulent, rough, non-pathogenic, non-capsulated).
- Four experiments - R-strain injected: the mouse survived. S-strain injected: mouse died. Heat-killed S-strain injected: the mouse survived. Live R-strain + Heat-killed S-strain injected: the mouse died.
- In the 4th experiment, live S-strain bacteria were recovered from the dead mouse's blood, even though only heat-killed S-strain was used alongside the R-strain.
- R-strain bacteria picked up something from the heat-killed S-strain, transformed into a virulent S-strain, and synthesised a smooth polysaccharide coat.
- Griffith called the unknown substance responsible for this change the "transforming principle", believed to be some form of genetic material.
- Griffith proved genetic material can transfer between bacteria, causing a permanent, heritable change, but did not identify what the transforming principle was (later proven to be DNA).
Key Points: Avery, McCarty and MacLeod’s Experiment
- In 1944, Oswald T. Avery, Colin M. MacLeod, and Maclyn McCarty proved that DNA is the genetic material (transforming principle).
- They used cell-free extracts of heat-killed S strain bacteria and mixed them with harmless R strain bacteria.
- Only DNA was able to transform the R strain into the virulent S strain, showing its role in heredity.
- Treatment with proteases and RNases did not stop transformation, proving that protein and RNA are not genetic material.
- Treatment with DNase stopped transformation, confirming that DNA is responsible for it.
- This experiment provided strong evidence that DNA is the hereditary material, though final confirmation came later from the Hershey and Chase experiment.
Key Points: The Hershey-Chase Experiment
- In 1952, Alfred Hershey and Martha Chase proved that DNA is the genetic material using bacteriophages and E. coli bacteria.
- They used radioactive isotopes: ³²P to label DNA and ³⁵S to label proteins.
- Viruses grown in ³²P medium had radioactive DNA, while those grown in ³⁵S medium had radioactive protein.
- These labelled viruses were allowed to infect E. coli, and then blending and centrifugation were done to separate viral coats.
- Only bacteria infected with ³²P-labelled viruses became radioactive, showing that DNA entered the bacterial cells.
- Bacteria infected with ³⁵S-labelled viruses were not radioactive, proving proteins did not enter the cells; hence, DNA is the genetic material.
Key Points: Structure of Eukaryotic Chromosome (Packaging of DNA)
- DNA is extremely long (about 2.2 m in humans) and needs to be highly compacted to fit inside very small cells.
- In prokaryotes, DNA is present in a nucleoid without a true nucleus and is organised into loops and supercoils with the help of HU proteins, DNA gyrase, and topoisomerase enzymes.
- In eukaryotes, DNA is associated with positively charged histone proteins rich in lysine and arginine, which help in packaging.
- DNA wraps around a histone octamer made of H2A, H2B, H3, and H4 to form nucleosomes, which are the basic repeating units of chromatin.
- Nucleosomes further coil into higher-order structures like 10 nm fibres, 30 nm solenoids, and looped domains with the help of histone H1 and non-histone chromosomal proteins, ultimately forming chromosomes.
- Chromatin exists in two forms: euchromatin, which is loosely packed and transcriptionally active, and heterochromatin, which is densely packed and transcriptionally inactive.
Key Points: DNA Replication
- DNA replication is the process of synthesis of DNA from parental DNA, occurring in the S-phase of interphase and follows a semi-conservative mode.
- It is semi-conservative, meaning each daughter DNA has one parental strand and one newly synthesized strand, as proved by Meselson and Stahl experiment (E. coli).
- Replication begins at a specific site called the origin (Ori), where nucleotides are activated, and DNA unwinds using the enzyme helicase, forming a replication fork.
- Single-strand binding proteins (SSB) stabilise separated strands, and RNA primers initiate synthesis of new strands.
- DNA polymerase synthesizes new strands in the 5’ → 3’ direction, continuously on the leading strand and discontinuously on the lagging strand.
- On the lagging strand, short DNA segments called Okazaki fragments are formed and later joined by DNA ligase.
- RNA primers are removed and replaced by DNA, and finally, two identical daughter DNA molecules are formed.
Key Points: Mechanism of DNA Replication
- Initiation at Origin: DNA replication begins at a specific site called the origin of replication; prokaryotes have a single origin, while eukaryotes have multiple origins (replicons).
- Unwinding of DNA: The DNA double helix is unwound and strands are separated by helicase, while topoisomerase (DNA gyrase) relieves supercoiling, forming replication forks.
- Primer Formation: A short RNA primer is synthesized by the enzyme primase to provide a free 3′-OH end for DNA synthesis.
- Elongation of New Strands: DNA polymerase adds nucleotides in the 5′ → 3′ direction using parental strands as templates; synthesis is continuous on the leading strand and discontinuous on the lagging strand forming Okazaki fragments.
- Completion and Ligation: RNA primers are removed, gaps are filled with DNA, and Okazaki fragments are joined by DNA ligase to form complete daughter DNA molecules.
Key Points: Semi-Conservative Replication
- Semiconservative replication means each new DNA molecule has one old (parental) strand and one newly synthesised strand.
- This was proved by Meselson and Stahl in 1958 using E. coli and density gradient centrifugation.
- E. coli were first grown in ¹⁵N (heavy nitrogen), so the DNA became heavy.
- When transferred to ¹⁴N (light nitrogen), after first generation a hybrid (¹⁴N–¹⁵N) DNA band was formed.
- After the second generation, two bands appeared (hybrid and light DNA), confirming semiconservative replication.
Key Points: Protein Synthesis
- Protein synthesis is the process by which cells produce proteins, which act as structural components, enzymes, and hormones.
- It involves two main steps: transcription (DNA → RNA) and translation (RNA → protein).
- In transcription, genetic information from DNA is copied into mRNA, where uracil (U) replaces thymine (T).
- Central dogma, proposed by Francis Crick (1958), states that information flows from DNA → RNA → protein.
- In retroviruses, reverse transcription occurs (RNA → DNA), explained by Temin and Baltimore (1970) using RNA-dependent DNA polymerase.
Key Points: Transcription
- Transcription is the process in which genetic information from one strand of DNA (template strand) is copied into RNA with the help of RNA polymerase.
- It occurs in the nucleoid in prokaryotes and in the nucleus in eukaryotes; mRNA then moves to the cytoplasm for translation.
- A transcription unit has three parts: promoter (start site), structural gene, and terminator (stop site).
- The process occurs in three stages: initiation (RNA polymerase binds promoter), elongation (RNA chain is formed), and termination (RNA polymerase detaches).
- Only one DNA strand acts as a template (3′→5′), while the other is the coding strand (5′→3′).
- In eukaryotes, primary RNA (hnRNA) is processed by capping, tailing, and splicing to form mature mRNA.
Key Points: Transcription Unit and the Gene
- A transcription unit is a segment of DNA consisting of a promoter (start site), a structural gene, and a terminator (end site).
- The template strand (3′→5′) is used for RNA synthesis, while the coding strand (5′→3′) has the same sequence as mRNA (except U replaces T).
- RNA polymerase binds to the promoter, synthesises RNA in 5′→3′ direction, and stops at the terminator.
- A gene is a DNA sequence that codes for RNA or protein; a cistron is a unit coding for a polypeptide.
- Monocistronic mRNA (in eukaryotes) has one gene per transcript, while polycistronic mRNA (in bacteria) has multiple genes in one transcript.
- In eukaryotes, three RNA polymerases are present: RNA polymerase I (rRNA), RNA polymerase II (mRNA/hnRNA), and RNA polymerase III (tRNA and snRNA).
Key Points: Transcription Unit
| Component | Location | Function |
|---|---|---|
| Promoter | At the 5′ end of the structural gene | Provides binding site for RNA polymerase and initiates transcription |
| Structural Gene | Between promoter and terminator | Contains genetic information to be transcribed |
| Template Strand | DNA strand with 3′ → 5′ polarity | Serves as template for RNA synthesis |
| Coding Strand | DNA strand with 5′ → 3′ polarity | Does not code directly; used as reference strand |
| Terminator | At the 3′ end of the coding strand | Signals the end of transcription |
Key Points: Genetic Code
- The genetic code is the relationship between the sequence of nucleotides in DNA/mRNA and the sequence of amino acids in a protein, thus controlling protein synthesis.
- It is a triplet code in which three consecutive nucleotides (codon) specify one amino acid, giving a total of 64 codons (4³ combinations).
- Out of 64 codons, 61 code for amino acids while 3 (UAA, UAG, UGA) act as stop codons, and AUG serves as the start codon coding for methionine.
- The genetic code is degenerate, meaning more than one codon can code for the same amino acid, often due to variation at the third base (wobble position).
- The triplet nature of the genetic code was confirmed by experiments such as frame-shift mutations by Francis Crick and the poly-U experiment by Marshall Nirenberg, which showed that UUU codes for phenylalanine.
- Further decoding of codons was achieved using synthetic RNA techniques developed by Har Gobind Khorana, helping establish the full genetic code dictionary.
- Changes (mutations) in the nucleotide sequence can alter amino acid sequences in proteins, showing that the genetic code directly determines protein structure and function.
Key Points: Characteristics of the Genetic Code
- The genetic code is a triplet code, where three nucleotides (codons) specify one amino acid.
- It has polarity and is always read in 5′ → 3′ direction.
- The genetic code is non-overlapping and commaless, meaning codons are read continuously without gaps.
- It is non-ambiguous, so one codon codes for only one specific amino acid.
- The genetic code shows degeneracy, where one amino acid can be coded by more than one codon.
- It is universal, meaning the same codon specifies the same amino acid in most organisms.
- AUG is the start codon (codes for methionine), while UAA, UAG, and UGA are stop codons that terminate protein synthesis.
Key Points: Mutations and Genetic Code
- Mutation studies help explain the relationship between genes and DNA; large mutations cause loss or gain of genes, while point mutations affect single base pairs.
- A point mutation in the β-globin gene (glutamate replaced by valine) causes the genetic disorder sickle-cell anaemia.
- Insertion or deletion of one or two bases shifts the reading frame of codons, producing frameshift mutations.
- Insertion or deletion of three or multiples of three bases removes or adds whole codons, so the reading frame remains unchanged.
Key Points: tRNA – the Adapter Molecule
- tRNA (transfer RNA) is called the adapter molecule because it links mRNA codons to their corresponding amino acids during the process of translation.
- The structure of tRNA resembles a cloverleaf in 2D (with loops and arms) and a hairpin/L-shape in 3D. It has two important sites — the anticodon loop (for codon recognition on mRNA) and the amino acid attachment site at the 3' end (acceptor end).
- tRNA has the following main structural parts: Acceptor arm (3' end, carries amino acid), TΨC arm/loop, DHU arm/loop, Anticodon arm with anticodon loop (recognises mRNA codon), and a Variable loop.
- The anticodon present on tRNA is complementary to the codon on mRNA. This ensures the correct amino acid is added during protein synthesis.
- The 3' end of tRNA always ends with the sequence CCA, where the amino acid attaches. The 5' end starts with G. Hydrogen bonds hold the structure together.
Key Points: Translation
- Translation is the process in which mRNA codons are read to form a sequence of amino acids, producing a polypeptide (protein) on ribosomes.
- It requires amino acids, mRNA, tRNA, ribosomes, ATP, Mg²⁺ ions, enzymes, and release factors.
- Ribosomes are the site of protein synthesis and have three tRNA binding sites: A site, P site, and E site.
- Initiation begins with the start codon AUG, where the initiator tRNA binds at the P site, and ribosomal subunits join.
- During elongation, amino acids are added one by one, peptide bonds are formed, and tRNA shifts from A site to P site.
- Termination occurs when a stop codon (UAA, UAG, UGA) is reached, the release factor binds, and the polypeptide chain is released.
Key Points: Mechanism of Translation
| Stage | Key Events | Enzymes / Factors Involved |
|---|---|---|
| Activation of Amino Acids | Amino acids are activated by ATP and attached to specific tRNA molecules | Aminoacyl-tRNA synthetase, ATP, Mg²⁺ |
| Role of Ribosome | Ribosome provides sites for mRNA binding and peptide synthesis; has A site and P site | rRNA, ribosomal proteins |
| Initiation | mRNA binds to small ribosomal subunit; initiator tRNA binds to start codon (AUG) at P site; large subunit joins | Initiation factors, Mg²⁺, GTP |
| Elongation | Aminoacyl-tRNA binds to A site; peptide bond forms; ribosome translocates along mRNA | Peptidyl transferase, elongation factors, GTP |
| Termination | Stop codon (UAA, UAG, UGA) is reached; polypeptide released; ribosome dissociates | Release factors, GTP |
| Post-translational Modification | Polypeptide undergoes folding and chemical modifications | Deformylase, peptidases |
| Protein Translocation | Proteins synthesized on free or bound ribosomes are transported to correct cellular locations | ER membrane, Golgi apparatus |
Key Points: Regulation of Gene Expression
- Gene regulation = switching genes ON or OFF based on the cell's requirement and stage of development.
- In eukaryotes, regulation occurs at 4 levels: Transcriptional (primary transcript), Processing (splicing), Transport (mRNA from nucleus to cytoplasm), and Translational.
- In prokaryotes, control of transcriptional initiation rate is the main site for gene expression control.
- E. coli produces β-galactosidase to break lactose → galactose + glucose. If lactose is absent, the enzyme is not produced, proving the environment regulates gene expression.
- Enzymes synthesized based on substrate availability are called inducible enzymes. The process = induction; the triggering molecule = inducer. This is a positive control.
- Feedback repression = when the end product (e.g., amino acid) is already available, genes for its production are switched OFF. This is a negative control.
Key Points: Operon Concept
- The operon model was given by F. Jacob & J. Monod (1961). It controls gene expression in prokaryotes and is based on the lac operon in E. coli.
- An operon has 4 parts — Regulator (makes repressor), Promoter (RNA Polymerase binds here), Operator (controls structural genes), and Structural genes (lac-z, lac-y, lac-a — encode enzymes for lactose digestion).
- The inducer is allolactose. It binds to the repressor, inactivates it, and allows transcription to occur.
- Without lactose (Operon OFF): Repressor binds to the operator → blocks RNA polymerase → no enzymes produced.
- With lactose (Operon ON): Lactose is converted to allolactose → inactivates repressor → operator is free → RNA polymerase transcribes → β-galactosidase, Permease, Transacetylase are produced → lactose broken down into galactose + glucose.
- The lac operon is an inducible operon — normally OFF, switched ON only when lactose is present.
- Important bonds — Hydrogen bond: links nitrogen bases; Glycosidic bond: base to sugar; Phosphoester bond: phosphate to sugar; Phosphodiester bond: links nucleotides; Peptide bond: links amino acids.
Key Points: The Lac Operon
- The lac operon is a gene regulatory system in E. coli that controls lactose metabolism by regulating transcription of structural genes. It includes the regulator gene (lacI), operator, promoter, and structural genes (z, y, a).
- The lacI gene produces a repressor protein that binds to the operator in the absence of lactose, preventing RNA polymerase from initiating transcription.
- In the absence of lactose, the operon remains “off” because the repressor blocks RNA polymerase, so structural genes are not expressed.
- In the presence of lactose, a small amount enters the cell via permease and is converted into allolactose by β-galactosidase.
- Allolactose acts as an inducer by binding to the repressor and changing its shape, inactivating it so it cannot bind the operator.
- Once the repressor is inactivated, RNA polymerase binds to the promoter and transcribes the structural genes, producing enzymes for lactose metabolism.
- This leads to the synthesis of β-galactosidase, permease, and transacetylase, enabling efficient utilisation of lactose.
Key Points: Genomics
- The genome is the complete genetic material of an organism, while genomics is the study of the entire genome, including sequencing, mapping, and gene functions.
- The term genome was introduced by H. Winkler (1920) and genomics by T.H. Roderick (1986).
- Genomics uses DNA sequencing, recombinant DNA technology, and bioinformatics tools to study the structure and function of genes.
- Genomics is divided into structural genomics (mapping and sequencing of genomes) and functional genomics (study of gene expression and function).
- Applications of genomics include the development of transgenic crops, gene therapy, forensic analysis using genetic markers, and the production of useful proteins and biofuels in microbes.
Key Points: Human Genome Project
- The Human Genome Project (HGP) was an international mega project launched in 1990 and completed in 2003 to sequence the entire human genome.
- It was coordinated mainly by the US Department of Energy and the National Institutes of Health (NIH), with participation from about 18 countries.
- The main aim was to identify all human genes, determine their locations, and sequence the complete human DNA (about 3.2 billion base pairs).
- The human genome contains approximately 20,000–25,000 genes, and less than 2% of DNA codes for proteins, while most consists of non-coding and repetitive sequences.
- The project used advanced techniques like automated DNA sequencing, cloning using BAC and YAC vectors, and genome mapping approaches.
- HGP revealed that about 99.9% of human DNA is identical, with variations such as SNPs and CNVs responsible for individual differences.
- The project has applications in disease diagnosis, gene therapy, genetic counselling, and understanding human evolution, along with ethical concerns related to genetic data use.
Key Points: DNA Fingerprinting
- DNA fingerprinting is a technique used to identify individuals based on unique patterns in their DNA, mainly using VNTRs (Variable Number Tandem Repeats), also called minisatellites.
- VNTRs are short repetitive DNA sequences that show high variation among individuals, making each DNA profile unique (except identical twins).
- The technique was developed by Alec Jeffreys and even a very small amount of DNA can be used for analysis.
- The process involves DNA extraction from samples like blood, hair, semen, or tissue, followed by PCR amplification if needed and restriction enzyme digestion.
- DNA fragments are separated using gel electrophoresis, transferred to a membrane by Southern blotting, and hybridised with specific VNTR probes.
- The hybridised DNA is visualized using autoradiography, producing a unique banding pattern for each individual.
- DNA fingerprinting is widely used in forensic science, paternity testing, criminal investigations, identification, genetic diversity studies, and disease diagnosis.
Key Points: Packaging in Prokaryotes
- Prokaryotes like E. coli do not have a true nucleus. Their DNA is present in a region called nucleoid.
- The DNA is very long but the cell is very small, so the DNA must be tightly packed inside the cell.
- The DNA becomes circular and folded into loops. About 40–50 loops are formed to reduce its size.
- The DNA is further coiled and supercoiled with the help of HU proteins, DNA gyrase and topoisomerase, so it fits inside the cell.
Key Points: Genomics
Key Points: Regulation of gene expression
- Gene expression is a multistep process by which a gene is regulated and its product (polypeptide/protein) is formed.
- In eukaryotes, gene expression is regulated at different levels such as transcription, RNA processing, mRNA transport, and translation.
- Genes are expressed only when needed to perform specific functions, for example β-galactosidase enzyme in E. coli helps in breaking lactose into glucose and galactose.
- If lactose is absent, E. coli does not produce β-galactosidase, showing that gene expression depends on environmental and metabolic conditions.
- Some bacterial genes are inducible, meaning they are switched on only in the presence of a substrate; this process is called induction and works by positive control.
Important Questions [37]
- Distinguish between heterochromatin and euchromatin with reference to staining property and activity.
- Histones are rich in ______.
- In an octamer of the nucleosome, core DNA consists of ______ base pairs.
- Attempt Any Two of the Following: with the Help of a Suitable Example Illustrate ‘Palindrome’.
- Draw a neat and labelled diagram of the Nucleosome.
- The Number of Adenine Molecules in a Given Dna Segment is 25 and the Number of Cytosine Molecules is 45, the Total Number of Nucleotides in the Segment is
- Describe the structure of a nucleosome.
- Explain the semi-conservative replication of eukaryotic DNA.
- How Co2 Makes Idlies Puffy?
- Explain Replication of Bacteriophage with the Help of a Suitable Diagram.
- How many amino acids will be there in the polypeptide chain formed on the following mRNA? 5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
- ______ enzymes are used as biological scissors in r-DNA technology.
- During the replication of DNA, the separated strands are prevented from recoiling by using ______.
- What is Bacteriophage?
- As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.
- Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
- What is the Correct Sequence of the Stages in Bacteriophage Lytic Cycle
- Give the different steps involved in formation of m-RNA from hn-RNA.
- What is Anticodon?
- Give Diagrammatic Representation to Show a Perfect Pairing and Any ‘Two’ Wobble Pairings.
- If the codon on m-RNA is AUG, the compatible anticodon on t-RNA is _______.
- What is 'Rna'?
- Explain Different Types of Non-genetic RNA with Diagrams and Functions.
- Give the central dogma of protein synthesis.
- Explain the process of translation.
- Answer the Following Question in ‘One’ Sentence Only: Enlist the Histones Which Form an Octamer of Nucleosome.
- Attempt Any Two of the Following: Define the Terms ‘Codon’ and ‘Anticodon’.
- Sketch and Label ‘Clover Leaf Model’ of T-rna.
- Enlist the characteristics of genetic code.
- What is transcription?
- Which One of the Following is a Stop Codon?
- State any three goals of the human genome project.
- Write the aims of the human genome project.
- The pairing of homologous chromosomes is call
- What Does Abbreviation HGP Stand For?
- In Which of the Following Haploid Cells a Whole Genome in Human Being is Present?
- Define ‘Genomics’. Give Any ‘Two’ Applications of It.
Concepts [24]
- Deoxyribonucleic Acid (DNA)
- Griffith’s Experiment
- Avery, McCarty and MacLeod’s Experiment
- The Hershey-Chase Experiment
- Packaging of DNA Helix
- DNA Replication
- Mechanism of DNA Replication
- Semi-Conservative Replication
- Protein Synthesis
- Transcription
- Transcription Unit and the Gene
- Genetic Code
- Characteristics of the Genetic Code
- Mutations and Genetic Code
- tRNA – the Adapter Molecule
- Translation
- Mechanism of Translation
- Regulation of Gene Expression
- Operon Concept
- The Lac Operon
- Genomics
- Human Genome Project
- DNA Fingerprinting
- Overview of Molecular Basis of Inheritance
