Central Dogma is the process where genetic information flows from DNA to RNA to protein, controlling cellular functions and body structure.
Definitions [21]
Definition: DNA packaging
The process by which a very long DNA molecule is compactly organised inside the cell nucleus so that it fits within the limited nuclear space and remains functional is called DNA packaging.
Definition: Nucleoid
Nucleoid is the region in prokaryotic cells where DNA is organized and associated with proteins, despite the absence of a true nucleus.
Definition: NHC Proteins
Proteins other than histones that are associated with chromatin and help in higher-order DNA packaging and regulation are called non-histone chromosomal (NHC) proteins.
Definition: Chromatin
The thread-like complex of DNA and proteins present in the nucleus of eukaryotic cells is called chromatin.
Definition: Nucleosome
The basic repeating unit of chromatin formed by DNA wrapped around a histone octamer is called nucleosome.
Definition: Histone Octamer
A structural unit composed of eight histone protein molecules around which DNA is wrapped is called histone octamer.
Definition: Histones
Positively charged basic proteins rich in lysine and arginine that associate with DNA to help in its packing in eukaryotic cells are called histones.
Define the Transfection.
Transfection is the process of inserting a vector into eukaryotic cells.
Define Translocation.
The movement of the ribosome from one end of the mRNA to the other end by the distance of one triplet codon during translation is known as translocation.
Define.
Translation
Translation is the process by which tRNA having anticodon to the codon on the mRNA, supplies amino acids, as per the message on mRNA.
Define the term codon.
A sequence of three adjacent nucleotides in mRNA that codes for one amino acid is known as a codon.
Definition: Central Dogma
Define mutation.
A sudden change that occurs in the nucleotide sequence of a gene, causing either a minor or considerable change in the characters of an individual is known as mutation.
Definition: DNA Fingerprinting
The technique of identifying an individual by analyzing the unique DNA sequence present in each person, similar to fingerprints, is called DNA fingerprinting.
Definition: Genetic Code
Definition: Polycistronic mRNA
A single mRNA molecule that carries information for more than one cistron is called polycistronic mRNA.
Definition: Cistron
An individual gene that codes for a single polypeptide chain is called a cistron.
Definition: Regulator Gene
A gene that produces the repressor protein is called a regulator gene.
Definition: Repressor Protein
A protein that binds to the operator and prevents transcription of structural genes is called a repressor protein.
Definition: Operator
A regulatory DNA sequence that controls transcription by allowing or blocking RNA polymerase binding is called an operator.
Definition: Operon
A long segment of DNA that contains an operator, promoter and a group of structural genes working together is called an operon.
Key Points
Key Points: Molecular Structure of DNA
1. DNA structure was first studied by Rosalind Franklin (1953); later explained by Watson and Crick, who proposed the double helix model (Nobel Prize, 1962).
2. DNA is a macromolecule made of two complementary strands twisted into a double helix.
3. Each strand is made up of nucleotides, which include phosphate, sugar (pentose), and a nitrogenous base.
4. There are four nitrogenous bases:
- Adenine (A) pairs with Thymine (T) (2 hydrogen bonds)
- Guanine (G) pairs with Cytosine (C) (3 hydrogen bonds)
5. The two strands form a ladder-like structure, with bases as rungs and sugar-phosphate as the backbone.
Key Points: Structure of Eukaryotic Chromosome (Packaging of DNA)
- In eukaryotes, chromosomes are gene carriers, and each chromosome consists of a single long DNA molecule associated with histone proteins (unineme model).
- DNA is packaged into repeating units called nucleosomes, where DNA is wrapped around a histone octamer made of H₂A, H₂B, H₃, and H₄ proteins.
- Nucleosomes form a 10 nm beaded fibre, which coils further into a 30 nm solenoid structure with the help of histone H₁.
- Higher-level folding condenses chromatin into looped domains attached to a protein scaffold, finally forming metaphase chromosomes with the help of non-histone chromosomal proteins.
- Chromatin exists as euchromatin (loosely packed, transcriptionally active) and heterochromatin (densely packed, transcriptionally inactive).
Key Points: The Lac Operon
- The operon model, proposed by Jacob and Monod (1961), explains coordinated regulation of gene expression in prokaryotes at the transcriptional level.
- An operon consists of a promoter, operator, and a group of structural genes that are regulated together and transcribed as a single polycistronic mRNA.
- In the lac operon of E. coli, three structural genes—z (β-galactosidase), y (permease), and a (transacetylase)—are involved in lactose metabolism.
- The regulator gene (lac i) produces a repressor protein that binds to the operator and prevents transcription in the absence of lactose.
- When lactose is present, it inactivates the repressor, allowing RNA polymerase to transcribe the structural genes (induction).
- Catabolite repression occurs when glucose is present; lac operon expression is suppressed and later activated by CAP–cAMP when glucose is depleted.
Key Points: Human Genome Project
- The Human Genome Project (HGP) was proposed in 1986 to map and sequence the entire human genome.
- It was an international effort involving about 100 laboratories from nearly 18 countries.
- The main goals included identifying all human genes, sequencing three billion base pairs, and storing data in databases.
- Two major approaches were used: Expressed Sequence Tags (ESTs) and whole genome sequencing with annotation.
- DNA fragments were cloned using BAC and YAC vectors in bacteria and yeast for sequencing.
- The human genome contains about 3.2 billion nucleotide bases and approximately 20,000–30,000 genes.
- Less than 2% of the genome codes for proteins, while repetitive DNA forms a large portion.
- About 99.9% of DNA sequences are identical among all humans; variations include SNPs and CNVs.
- HGP has applications in disease diagnosis, genetic counselling, gene therapy, and understanding human evolution.
- Ethical concerns include misuse of genetic data for discrimination, insurance denial, and attempts at genetic manipulation.
Key Points: DNA Fingerprinting
- DNA fingerprinting is a technique used to identify individuals based on unique patterns in their DNA sequences.
- It is based on repetitive DNA sequences called VNTRs (Variable Number Tandem Repeats), which show high polymorphism among individuals.
- These repetitive sequences are part of satellite DNA, including minisatellites and microsatellites.
- The technique was developed by Alec Jeffreys, and even a very small DNA sample can be used.
- The main steps include DNA extraction, PCR amplification, restriction digestion, gel electrophoresis, Southern blotting, hybridisation, and autoradiography.
- The resulting banding pattern is unique for each individual, except in identical (monozygotic) twins.
- DNA fingerprinting is widely used in forensic science, paternity testing, and personal identification.
- It is also useful in studying genetic diversity, population structure, and diagnosing certain inherited diseases.
Key Points: Genetic Code
- The genetic code is the specific sequence of nitrogenous bases in DNA or mRNA that determines the order of amino acids in a protein.
- It is a triplet code, where a sequence of three nucleotides called a codon codes for one amino acid.
- There are 64 codons (4³), of which 61 code for amino acids and 3 act as stop codons (UAA, UAG, UGA).
- AUG functions as the start codon and codes for the amino acid methionine.
- The genetic code is degenerate, meaning more than one codon can code for the same amino acid, showing the wobble effect at the third base.
Key Points: Mechanism of Translation
| Stage | Key Events | Enzymes / Factors Involved |
|---|---|---|
| Activation of Amino Acids | Amino acids are activated by ATP and attached to specific tRNA molecules | Aminoacyl-tRNA synthetase, ATP, Mg²⁺ |
| Role of Ribosome | Ribosome provides sites for mRNA binding and peptide synthesis; has A site and P site | rRNA, ribosomal proteins |
| Initiation | mRNA binds to small ribosomal subunit; initiator tRNA binds to start codon (AUG) at P site; large subunit joins | Initiation factors, Mg²⁺, GTP |
| Elongation | Aminoacyl-tRNA binds to A site; peptide bond forms; ribosome translocates along mRNA | Peptidyl transferase, elongation factors, GTP |
| Termination | Stop codon (UAA, UAG, UGA) is reached; polypeptide released; ribosome dissociates | Release factors, GTP |
| Post-translational Modification | Polypeptide undergoes folding and chemical modifications | Deformylase, peptidases |
| Protein Translocation | Proteins synthesized on free or bound ribosomes are transported to correct cellular locations | ER membrane, Golgi apparatus |
Key Points: Genomics
Key Points: Regulation of gene expression
- Gene expression is a multistep process by which a gene is regulated and its product (polypeptide/protein) is formed.
- In eukaryotes, gene expression is regulated at different levels such as transcription, RNA processing, mRNA transport, and translation.
- Genes are expressed only when needed to perform specific functions, for example β-galactosidase enzyme in E. coli helps in breaking lactose into glucose and galactose.
- If lactose is absent, E. coli does not produce β-galactosidase, showing that gene expression depends on environmental and metabolic conditions.
- Some bacterial genes are inducible, meaning they are switched on only in the presence of a substrate; this process is called induction and works by positive control.
Key Points: Packaging in Prokaryotes
- Prokaryotes like E. coli do not have a true nucleus. Their DNA is present in a region called nucleoid.
- The DNA is very long but the cell is very small, so the DNA must be tightly packed inside the cell.
- The DNA becomes circular and folded into loops. About 40–50 loops are formed to reduce its size.
- The DNA is further coiled and supercoiled with the help of HU proteins, DNA gyrase and topoisomerase, so it fits inside the cell.
Important Questions [35]
- Draw a neat and labelled diagram of the Nucleosome.
- Attempt Any Two of the Following: with the Help of a Suitable Example Illustrate ‘Palindrome’.
- The Number of Adenine Molecules in a Given Dna Segment is 25 and the Number of Cytosine Molecules is 45, the Total Number of Nucleotides in the Segment is
- Histones are rich in ______.
- In an octamer of the nucleosome, core DNA consists of ______ base pairs.
- Distinguish between heterochromatin and euchromatin with reference to staining property and activity.
- Describe the structure of a nucleosome.
- Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
- What is Bacteriophage?
- How Co2 Makes Idlies Puffy?
- Explain Replication of Bacteriophage with the Help of a Suitable Diagram.
- During the replication of DNA, the separated strands are prevented from recoiling by using ______.
- As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.
- What is the Correct Sequence of the Stages in Bacteriophage Lytic Cycle
- Explain the semi-conservative replication of eukaryotic DNA.
- ______ enzymes are used as biological scissors in r-DNA technology.
- How many amino acids will be there in the polypeptide chain formed on the following mRNA? 5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
- Give the different steps involved in formation of m-RNA from hn-RNA.
- Give Diagrammatic Representation to Show a Perfect Pairing and Any ‘Two’ Wobble Pairings.
- If the codon on m-RNA is AUG, the compatible anticodon on t-RNA is _______.
- What is 'Rna'?
- Explain Different Types of Non-genetic RNA with Diagrams and Functions.
- Give the central dogma of protein synthesis.
- Explain the process of translation.
- Answer the Following Question in ‘One’ Sentence Only: Enlist the Histones Which Form an Octamer of Nucleosome.
- Attempt Any Two of the Following: Define the Terms ‘Codon’ and ‘Anticodon’.
- Sketch and Label ‘Clover Leaf Model’ of T-rna.
- Enlist the characteristics of genetic code.
- What is Anticodon?
- State Any Three Goals of the Human Genome Project
- Write the aims of the human genome project.
- The pairing of homologous chromosomes is call
- What Does Abbreviation HGP Stand For?
- In Which of the Following Haploid Cells a Whole Genome in Human Being is Present?
- Define ‘Genomics’. Give Any ‘Two’ Applications of It.
