Advertisements
Advertisements
Question
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
Advertisements
Solution
In eukaryotes, the hnRNA (heterogeneous nuclear RNA) is the direct product of transcription and contains both coding exons and non-coding introns. To become functional mRNA, it must undergo three essential processing steps within the nucleus:
- Splicing: This is the most critical step, where the non-functional introns are removed, and the functional exons are joined together in a specific order. This process is carried out by a complex called the spliceosome.
- Capping: A unique nucleotide, methyl guanosine triphosphate, is added to the 5’ end of the hnRNA. This “cap” protects the RNA from degradation and helps the ribosome recognise it during translation.
- Tailing (Polyadenylation): About 200–300 adenylate residues are added to the 3’ end of the RNA, forming what is known as a poly-A tail. This tail assists in the export of the mRNA from the nucleus and further stabilises the molecule.
Once these three modifications are complete, the processed transcript is called mature mRNA and is then transported out of the nucleus into the cytoplasm for protein synthesis.
RELATED QUESTIONS
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Explain the process of transcription in prokaryotes.
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Briefly describe the following:
Transcription
Transcription is the transfer of genetic code from a DNA molecule to ______.
What is the central dogma?
A mRNA molecule is produced by ______.
Which of the following is the correct sequence of event with reference to the central dogma?
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
In a cell, DNA transcription is halted when ______
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
In the processing of hnRNA in eukaryotic cell, the primary transcripts are processed in the following sequence.
