Advertisements
Advertisements
Question
Explain the role of initiator tRNA in the initiation of protein synthesis.
Advertisements
Solution
Initiator tRNA carries amino acid methionine at its amino acid binding site and has anticodon UCA at its anticodon binding site. Initiator tRNA binds with the codon (AUG) present on the mRNA and in this way the initiator tRNA plays a role in the initiation of protein synthesis.
APPEARS IN
RELATED QUESTIONS
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Describe the process of transcription in bacteria
How is Prokaryotic Transcription process different in eukaryotes?
What are introns?
What is the central dogma?
Explain the mechanism of transcription in a prokaryotic cell.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Which is not involved in protein synthesis?
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
