Advertisements
Advertisements
Question
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
Advertisements
Solution
RNA polymerase III is responsible for transcription of tRNA and methionine is the amino acid that gets linked with the initiator tRNA.
APPEARS IN
RELATED QUESTIONS
How do m-RNA, t-RNA and ribosomes help in the process of translation?
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
A mRNA molecule is produced by ______.
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
Which is not involved in protein synthesis?
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
