Advertisements
Advertisements
Question
A mRNA molecule is produced by ______.
Options
Replication
Transcription
Duplication
Translation
Advertisements
Solution
A mRNA molecule is produced by transcription.
Explanation:
mRNA is synthesised from a DNA template during transcription. RNA polymerase makes a complementary single-stranded mRNA from one DNA strand. Replication makes copies of DNA, duplication is not the standard term for mRNA synthesis, and translation uses mRNA to build proteins.
APPEARS IN
RELATED QUESTIONS
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Describe the process of transcription in bacteria
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Explain the process of transcription in prokaryotes.
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
What are introns?
Initiation codon of protein synthesis in Eukaryotes is ______.
Which of the following is the correct sequence of event with reference to the central dogma?
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
Reverse transcriptase is ______.
Which is not involved in protein synthesis?
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
In the processing of hnRNA in eukaryotic cell, the primary transcripts are processed in the following sequence.
