Advertisements
Advertisements
Question
A mRNA molecule is produced by ______.
Options
Replication
Transcription
Duplication
Translation
Advertisements
Solution
A mRNA molecule is produced by transcription.
Explanation:
mRNA is synthesised from a DNA template during transcription. RNA polymerase makes a complementary single-stranded mRNA from one DNA strand. Replication makes copies of DNA, duplication is not the standard term for mRNA synthesis, and translation uses mRNA to build proteins.
APPEARS IN
RELATED QUESTIONS
How is Prokaryotic Transcription process different in eukaryotes?
Explain the role of initiator tRNA in the initiation of protein synthesis.
What is the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
Reverse transcriptase is ______.
Which is not involved in protein synthesis?
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
Which factor is important for termination of transcription?
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
In the processing of hnRNA in eukaryotic cell, the primary transcripts are processed in the following sequence.
Which enzyme is responsible for catalyzing the transcription process?
In eukaryotes, where does transcription occur?
Which part of a transcription unit serves as the stop site for transcription?
How many stages does transcription occur in?
In eukaryotes, what is the name of the primary RNA product immediately after transcription?
