Advertisements
Advertisements
Question
How is the two stage process of protein synthesis advantageous?
Advertisements
Solution
The split gene feature of eukaryotic genes is almost entirely absent in prokaryotes. Originally each exon may have coded for a single polypeptide chain with a specific function. Since exon arrangement and intron removal are flexible, the exon coding for these polypeptide subunits act as domains combining in various ways to form new genes. Single genes can produce different functional proteins by arranging their exons in several different ways through alternate splicing patterns, a mechanism known to play an important role in generating both protein and functional diversity in animals.
Introns would have arose before or after the evolution of the eukaryotic gene. If introns arose late how did they enter the eukaryotic gene? Introns are mobile DNA sequences that can splice themselves out of, as well as into, specific ‘target sites’ acting like mobile transposon-like elements (that mediate transfer of genes between organisms - Horizontal Gene Transfer - HGT). HGT occurs between lineages of prokaryotic cells, or from prokaryotic to eukaryotic cells, and between eukaryotic cells. HGT is now hypothesized to have played a major role in the evolution of life on Earth.
RELATED QUESTIONS
Describe the process of transcription in bacteria
How do m-RNA, t-RNA and ribosomes help in the process of translation?
State the aim and describe Messelson and Stahl’s experiment.
Transcription is the transfer of genetic code from a DNA molecule to:
(i) RNA molecule
(ii) Second DNA molecule
(iii) Ribosomal sub unit·
(iv) Sequence of amino acids in a protein molecule
Explain the mechanism of transcription in a prokaryotic cell.
A mRNA molecule is produced by ____________.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
Which is not involved in protein synthesis?
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
