Advertisements
Advertisements
Question
How is the two stage process of protein synthesis advantageous?
Advertisements
Solution
The split gene feature of eukaryotic genes is almost entirely absent in prokaryotes. Originally each exon may have coded for a single polypeptide chain with a specific function. Since exon arrangement and intron removal are flexible, the exon coding for these polypeptide subunits act as domains combining in various ways to form new genes. Single genes can produce different functional proteins by arranging their exons in several different ways through alternate splicing patterns, a mechanism known to play an important role in generating both protein and functional diversity in animals.
Introns would have arose before or after the evolution of the eukaryotic gene. If introns arose late how did they enter the eukaryotic gene? Introns are mobile DNA sequences that can splice themselves out of, as well as into, specific ‘target sites’ acting like mobile transposon-like elements (that mediate transfer of genes between organisms - Horizontal Gene Transfer - HGT). HGT occurs between lineages of prokaryotic cells, or from prokaryotic to eukaryotic cells, and between eukaryotic cells. HGT is now hypothesized to have played a major role in the evolution of life on Earth.
RELATED QUESTIONS
Briefly describe the following:
Transcription
How is Prokaryotic Transcription process different in eukaryotes?
What are introns?
Explain the mechanism of transcription in a prokaryotic cell.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
Reverse transcriptase is ______.
Which is not involved in protein synthesis?
In a cell, DNA transcription is halted when ______
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
