Advertisements
Advertisements
प्रश्न
How is the two stage process of protein synthesis advantageous?
Advertisements
उत्तर
The split gene feature of eukaryotic genes is almost entirely absent in prokaryotes. Originally each exon may have coded for a single polypeptide chain with a specific function. Since exon arrangement and intron removal are flexible, the exon coding for these polypeptide subunits act as domains combining in various ways to form new genes. Single genes can produce different functional proteins by arranging their exons in several different ways through alternate splicing patterns, a mechanism known to play an important role in generating both protein and functional diversity in animals.
Introns would have arose before or after the evolution of the eukaryotic gene. If introns arose late how did they enter the eukaryotic gene? Introns are mobile DNA sequences that can splice themselves out of, as well as into, specific ‘target sites’ acting like mobile transposon-like elements (that mediate transfer of genes between organisms - Horizontal Gene Transfer - HGT). HGT occurs between lineages of prokaryotic cells, or from prokaryotic to eukaryotic cells, and between eukaryotic cells. HGT is now hypothesized to have played a major role in the evolution of life on Earth.
संबंधित प्रश्न
Transcription is the transfer of genetic code from a DNA molecule to ______.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
In a cell, DNA transcription is halted when ______
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
In eukaryotes, where does transcription occur?
What is the direction of the coding strand?
Which part of a transcription unit serves as the start site for transcription?
What happens during the initiation stage of transcription?
What occurs during the elongation stage of transcription?
Which three post-transcriptional modifications convert hnRNA into mature mRNA in eukaryotes?
