Advertisements
Advertisements
Question
Explain the process of transcription in prokaryotes.
Advertisements
Solution
Transcription is the process of the formation of the m-RNA strand on a DNA strand in the nucleus. It takes place in three steps—initiation, elongation and termination.
(a) Initiation:
i. In prokaryotes, the structural genes are polycistronic and continuous.
ii. A single DNA-dependent RNA polymerase catalyses transcription of all the three types of RNA (mRNA, tRNA and rRNA).
iii. RNA polymerase binds to the promoter region and starts the process of transcription. The RNA polymerase enzyme contains a detachable subunit called the sigma (σ) factor. It helps the enzyme to bind firmly to DNA.
iv. The RNA core polymerase (minus sigma factor) moves down DNA at a faster pace and this continues to synthesise a new RNA chain.
(b) Elongation:
i. Ribonucleoside triphosphates help in the polymerisation on a DNA template, following the rule of complementarity.
ii. The enzyme facilitates the opening of the DNA helix and continues elongation.
(c) Termination: The process of elongation during transcription continues until the enzyme, RNA core polymerase reaches the terminator sequence in the sense DNA strand (3′–AAAAAAT–5′). At this point, another protein particle, the rho (ρ) factor, forms a complex with RNA-polymerase. This causes the enzyme to go off the DNA track, and thus, new m-RNA is released.

APPEARS IN
RELATED QUESTIONS
Describe the process of transcription in bacteria
Briefly describe the following:
Transcription
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
Reverse transcriptase is ______.
In a cell, DNA transcription is halted when ______
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
In the processing of hnRNA in eukaryotic cell, the primary transcripts are processed in the following sequence.
