Advertisements
Advertisements
प्रश्न
Explain the process of transcription in prokaryotes.
Advertisements
उत्तर
Transcription is the process of the formation of the m-RNA strand on a DNA strand in the nucleus. It takes place in three steps—initiation, elongation and termination.
(a) Initiation:
i. In prokaryotes, the structural genes are polycistronic and continuous.
ii. A single DNA-dependent RNA polymerase catalyses transcription of all the three types of RNA (mRNA, tRNA and rRNA).
iii. RNA polymerase binds to the promoter region and starts the process of transcription. The RNA polymerase enzyme contains a detachable subunit called the sigma (σ) factor. It helps the enzyme to bind firmly to DNA.
iv. The RNA core polymerase (minus sigma factor) moves down DNA at a faster pace and this continues to synthesise a new RNA chain.
(b) Elongation:
i. Ribonucleoside triphosphates help in the polymerisation on a DNA template, following the rule of complementarity.
ii. The enzyme facilitates the opening of the DNA helix and continues elongation.
(c) Termination: The process of elongation during transcription continues until the enzyme, RNA core polymerase reaches the terminator sequence in the sense DNA strand (3′–AAAAAAT–5′). At this point, another protein particle, the rho (ρ) factor, forms a complex with RNA-polymerase. This causes the enzyme to go off the DNA track, and thus, new m-RNA is released.

APPEARS IN
संबंधित प्रश्न
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
Explain the role of initiator tRNA in the initiation of protein synthesis.
What are introns?
What is the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
