Advertisements
Advertisements
प्रश्न
Explain the role of initiator tRNA in the initiation of protein synthesis.
Advertisements
उत्तर
Initiator tRNA carries amino acid methionine at its amino acid binding site and has anticodon UCA at its anticodon binding site. Initiator tRNA binds with the codon (AUG) present on the mRNA and in this way the initiator tRNA plays a role in the initiation of protein synthesis.
APPEARS IN
संबंधित प्रश्न
Describe the process of transcription in bacteria
State the aim and describe Messelson and Stahl’s experiment.
Briefly describe the following:
Transcription
Initiation codon of protein synthesis in Eukaryotes is ______.
What is the central dogma?
Explain the mechanism of transcription in a prokaryotic cell.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
