Advertisements
Advertisements
प्रश्न
Explain the role of initiator tRNA in the initiation of protein synthesis.
Advertisements
उत्तर
Initiator tRNA carries amino acid methionine at its amino acid binding site and has anticodon UCA at its anticodon binding site. Initiator tRNA binds with the codon (AUG) present on the mRNA and in this way the initiator tRNA plays a role in the initiation of protein synthesis.
APPEARS IN
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Briefly describe the following:
Transcription
Transcription is the transfer of genetic code from a DNA molecule to ______.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
Reverse transcriptase is ______.
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
Which factor is important for termination of transcription?
