हिंदी
कर्नाटक बोर्ड पी.यू.सी.पीयूसी विज्ञान 2nd PUC Class 12

Briefly describe the following: Transcription - Biology

Advertisements
Advertisements

प्रश्न

Briefly describe the following:

Transcription 

विस्तार में उत्तर
Advertisements

उत्तर

Transcription is the process of synthesising RNA from a DNA template. A segment of DNA gets copied into mRNA during the process. The process of transcription starts at the promoter region of the template DNA and terminates at the terminator region. The segment of DNA between these two regions is known as a transcription unit. The transcription requires RNA polymerase enzyme, a DNA template, four types of ribonucleotides, and certain cofactors such as Mg2+.

The three important events that occur during the process of transcription are as follows.

  1. Initiation
  2. Elongation
  3. Termination

The DNA-dependent RNA polymerase and certain initiation factors (σ) bind at the double-stranded DNA at the promoter region of the template strand and initiate the process of transcription. RNA polymerase moves along the DNA and leads to the unwinding of the DNA duplex into two separate strands. Then, one of the strands, called the sense strand, acts as a template for mRNA synthesis. The enzyme RNA polymerase uses nucleoside triphosphates (dNTPs) as raw materials and polymerises them to form mRNA according to the complementary bases present on the template DNA. This process of opening of helix and elongation of polynucleotide chain continues until the enzyme reaches the terminator region. As RNA polymerase reaches the terminator region, the newly synthesised mRNA transcript along with the enzyme is released. Another factor called terminator factor (ρ) is required for the termination of the transcription.

shaalaa.com
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?

वीडियो ट्यूटोरियलVIEW ALL [1]

संबंधित प्रश्न

Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.


Describe the process of transcription in bacteria


Explain the process of transcription in prokaryotes.


(i) Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
(ii) Explain the basis on which he arrived at this conclusion.


State the aim and describe Messelson and Stahl’s experiment.


How is Prokaryotic Transcription process different in eukaryotes?


Explain the processing the hnRNA needs to undergo before becoming functional mRNA eukaryotes.


What is the central dogma?


Which of the following is the correct sequence of event with reference to the central dogma?


If the coding sequence in a transcription unit is written as follows:

5' TGCATGCATGCATGCATGCATGCATGC 3'

Write down the sequence of mRNA.


The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.


Reverse transcriptase is ______.


DNA template sequence of CTGATAGC is transcribed over mRNA as ______.


Which is not involved in protein synthesis?


In a cell, DNA transcription is halted when ______ 


Read the following and answer from given below:

The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.

Which ion is essential for the association of both units of the ribosome at the time of protein formation?


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×