Advertisements
Advertisements
प्रश्न
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides. Explain the basis on which he arrived at this conclusion.
Advertisements
उत्तर
- George Gamow suggested that the genetic code should be made up of a combination of three nucleotides.
- He proposed that if 20 amino acids are to be coded by 4 bases, then the code should be made up of three nucleotides. 43 = 64 (42 = 16), which is less than 20. So, the codon was proposed to be a triplet.
APPEARS IN
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Explain the process of transcription in prokaryotes.
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
State the aim and describe Messelson and Stahl’s experiment.
Briefly describe the following:
Transcription
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
Explain the role of initiator tRNA in the initiation of protein synthesis.
Explain the mechanism of transcription in a prokaryotic cell.
A mRNA molecule is produced by ______.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
Which is not involved in protein synthesis?
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
