Advertisements
Advertisements
प्रश्न
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides. Explain the basis on which he arrived at this conclusion.
Advertisements
उत्तर
- George Gamow suggested that the genetic code should be made up of a combination of three nucleotides.
- He proposed that if 20 amino acids are to be coded by 4 bases, then the code should be made up of three nucleotides. 43 = 64 (42 = 16), which is less than 20. So, the codon was proposed to be a triplet.
APPEARS IN
संबंधित प्रश्न
State the aim and describe Messelson and Stahl’s experiment.
Briefly describe the following:
Transcription
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
Explain the role of initiator tRNA in the initiation of protein synthesis.
What are introns?
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
In a cell, DNA transcription is halted when ______
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
How many DNA strands serve as the template strand during transcription?
What is the direction of the template strand during transcription?
What is the direction of the coding strand?
Which part of a transcription unit serves as the start site for transcription?
Which part of a transcription unit serves as the stop site for transcription?
What happens during the initiation stage of transcription?
Which three post-transcriptional modifications convert hnRNA into mature mRNA in eukaryotes?
