Advertisements
Advertisements
प्रश्न
How is Prokaryotic Transcription process different in eukaryotes?
Advertisements
उत्तर
Differences between prokaryotic and eukaryotic transcription:
| Prokaryotic Transcription | Eukaryotic Transcription |
| 1. It occurs in the cytoplasm | 1. It occurs in the nucleus. |
| 2. There is no specific period for prokaryotic transcription to occur. | 2. It occurs in the G1 and G2 phases. |
| 3. Products of transcription become effective in situ. | 3. Transcription products come out of the nucleus for functioning in the cytoplasm. |
| 4. mRNA is generally polycistronic | 4. mRNA is generally monocistronic. |
APPEARS IN
संबंधित प्रश्न
Describe the process of transcription in bacteria
How do m-RNA, t-RNA and ribosomes help in the process of translation?
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
What is the central dogma?
Explain the mechanism of transcription in a prokaryotic cell.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
