Advertisements
Advertisements
प्रश्न
A mRNA molecule is produced by ______.
पर्याय
Replication
Transcription
Duplication
Translation
Advertisements
उत्तर
A mRNA molecule is produced by transcription.
Explanation:
mRNA is synthesised from a DNA template during transcription. RNA polymerase makes a complementary single-stranded mRNA from one DNA strand. Replication makes copies of DNA, duplication is not the standard term for mRNA synthesis, and translation uses mRNA to build proteins.
APPEARS IN
संबंधित प्रश्न
Describe the process of transcription in bacteria
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Explain the process of transcription in prokaryotes.
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
Explain the role of initiator tRNA in the initiation of protein synthesis.
Initiation codon of protein synthesis in Eukaryotes is ______.
Explain the mechanism of transcription in a prokaryotic cell.
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Reverse transcriptase is ______.
Which is not involved in protein synthesis?
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
Which factor is important for termination of transcription?
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
