Advertisements
Advertisements
प्रश्न
A mRNA molecule is produced by ______.
पर्याय
Replication
Transcription
Duplication
Translation
Advertisements
उत्तर
A mRNA molecule is produced by transcription.
Explanation:
mRNA is synthesised from a DNA template during transcription. RNA polymerase makes a complementary single-stranded mRNA from one DNA strand. Replication makes copies of DNA, duplication is not the standard term for mRNA synthesis, and translation uses mRNA to build proteins.
APPEARS IN
संबंधित प्रश्न
Describe the process of transcription in bacteria
How do m-RNA, t-RNA and ribosomes help in the process of translation?
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
How is Prokaryotic Transcription process different in eukaryotes?
Explain the role of initiator tRNA in the initiation of protein synthesis.
What is the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Which is not involved in protein synthesis?
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
Which factor is important for termination of transcription?
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
Which nucleotide replaces thymine during the transcription process when RNA is synthesized?
In eukaryotes, where does transcription occur?
A transcription unit consists of how many major parts?
Which part of a transcription unit serves as the start site for transcription?
Which part of a transcription unit serves as the stop site for transcription?
How many stages does transcription occur in?
