Advertisements
Advertisements
प्रश्न
What are introns?
Advertisements
उत्तर
Introns are non-coding sections of an RNA transcript or the DNA encoding it that are spliced out before the RNA molecule is translated into a protein.
APPEARS IN
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Explain the role of initiator tRNA in the initiation of protein synthesis.
Transcription is the transfer of genetic code from a DNA molecule to ______.
Which of the following is the correct sequence of event with reference to the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Reverse transcriptase is ______.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
In prokaryotes, where does transcription occur?
