Advertisements
Advertisements
प्रश्न
What are introns?
Advertisements
उत्तर
Introns are non-coding sections of an RNA transcript or the DNA encoding it that are spliced out before the RNA molecule is translated into a protein.
APPEARS IN
संबंधित प्रश्न
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
What is the central dogma?
Explain the mechanism of transcription in a prokaryotic cell.
A mRNA molecule is produced by ______.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
In the processing of hnRNA in eukaryotic cell, the primary transcripts are processed in the following sequence.
