Advertisements
Advertisements
प्रश्न
What are introns?
Advertisements
उत्तर
Introns are non-coding sections of an RNA transcript or the DNA encoding it that are spliced out before the RNA molecule is translated into a protein.
APPEARS IN
संबंधित प्रश्न
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
Explain the role of initiator tRNA in the initiation of protein synthesis.
What is the central dogma?
Explain the mechanism of transcription in a prokaryotic cell.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
In a cell, DNA transcription is halted when ______
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
