Advertisements
Advertisements
प्रश्न
Which of the following is the correct sequence of event with reference to the central dogma?
पर्याय
Transcription, Translation, Replication
Transcription, Replication, Translation
Duplication, Translation, Transcription
Replication, Transcription, Translation
Advertisements
उत्तर
Replication, Transcription, Translation
Explanation:
The Central Dogma describes the fundamental flow of genetic information within a biological system, typically following a specific three-step sequence:
- Replication: The process by which DNA makes an exact copy of itself, ensuring genetic continuity during cell division.
- Transcription: The genetic code from a DNA template is used to synthesise a complementary messenger RNA (mRNA) molecule.
- Translation: The sequence of nucleotides in the mRNA is decoded at the ribosome to assemble amino acids into a specific protein.
APPEARS IN
संबंधित प्रश्न
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
State the aim and describe Messelson and Stahl’s experiment.
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
Explain the role of initiator tRNA in the initiation of protein synthesis.
Transcription is the transfer of genetic code from a DNA molecule to ______.
Initiation codon of protein synthesis in Eukaryotes is ______.
What is the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
Reverse transcriptase is ______.
Which is not involved in protein synthesis?
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
In the processing of hnRNA in eukaryotic cell, the primary transcripts are processed in the following sequence.
