मराठी

What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?

Advertisements
Advertisements

प्रश्न

What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?

पर्याय

  • Origin of replication occurs only at the 5’ end of the molecules.

  • DNA ligase works only in the 3’ → 5’ direction.

  • DNA polymerase can join new nucleotides only to the 3’ end of the growing strand.

  • Helicases and single-strand binding proteins that work at the 5’ end.

MCQ
Advertisements

उत्तर

DNA polymerase can join new nucleotides only to the 3’ end of the growing strand.

Explanation:

The primary reason for the difference in synthesis is the directional constraint of the enzyme DNA polymerase, which can only add new nucleotides in the 3’ → 5’ direction. Because the two strands of the DNA double helix are antiparallel (running in opposite directions), only one strand, the leading strand, can be synthesised continuously as the replication fork opens. The other strand, known as the lagging strand, must be synthesised in short, discontinuous segments called Okazaki fragments because its template runs in a direction that forces the polymerase to move away from the expanding replication fork to find a free 3’ end.

shaalaa.com
  या प्रश्नात किंवा उत्तरात काही त्रुटी आहे का?
पाठ 5: Molecular Genetics - Evaluation [पृष्ठ ८४]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
पाठ 5 Molecular Genetics
Evaluation | Q 6. | पृष्ठ ८४
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
पाठ 5 Molecular Genetics
Evaluation | Q 6. | पृष्ठ ८७
नूतन Biology [English] Class 12 ISC
पाठ 5 Molecular Basis of Inheritance
TEST YOUR PROGRESS | Q 1. 29 | पृष्ठ २६४

संबंधित प्रश्‍न

______ enzymes are used as biological scissors in r-DNA technology.


Explain replication of bacteriophage with the help of a suitable diagram.


What is the function of an RNA primer during protein synthesis?


Very Short Answer Question:

Why are Okazaki fragments formed on lagging strand only?


Very Short Answer Question:

When does DNA replication takes place?


Okasaki fragments are joined together by ______.


E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?


Which of the following statements is not true about DNA replication in eukaryotes?


Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.


Read the following statements and select the correct option.

i. The unit of DNA in which replication occurs, is called replicon.

ii. In eukaryotes, there is only one replicon however in prokaryotes there are several replicons in tandem.


During DNA replication, Okazaki fragments are used to elongate ____________.


The addition of nucleotides on the lagging strand occurs ____________ during DNA replication.


Which one of the following can form a nucleotide of DNA?


When the DNA molecule appears like inverted Y, it is ______


Okazaki is known for his contribution to the under tanding of:


Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.


How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'


Which of the following statement is correct regarding the process of replication in E.coli?


In eukaryotic organisms, replication of DNA occurs in ______.


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×