English

What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules? - Biology (Theory)

Advertisements
Advertisements

Question

What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?

Options

  • Origin of replication occurs only at the 5’ end of the molecules.

  • DNA ligase works only in the 3’ → 5’ direction.

  • DNA polymerase can join new nucleotides only to the 3’ end of the growing strand.

  • Helicases and single-strand binding proteins that work at the 5’ end.

MCQ
Advertisements

Solution

DNA polymerase can join new nucleotides only to the 3’ end of the growing strand.

Explanation:

The primary reason for the difference in synthesis is the directional constraint of the enzyme DNA polymerase, which can only add new nucleotides in the 3’ → 5’ direction. Because the two strands of the DNA double helix are antiparallel (running in opposite directions), only one strand, the leading strand, can be synthesised continuously as the replication fork opens. The other strand, known as the lagging strand, must be synthesised in short, discontinuous segments called Okazaki fragments because its template runs in a direction that forces the polymerase to move away from the expanding replication fork to find a free 3’ end.

shaalaa.com
DNA Replication
  Is there an error in this question or solution?
Chapter 5: Molecular Genetics - Evaluation [Page 84]

APPEARS IN

Samacheer Kalvi Biology (Zoology) [English] Class 12 TN Board
Chapter 5 Molecular Genetics
Evaluation | Q 6. | Page 84
Samacheer Kalvi Biology (Zoology) [English] Class 12 TN Board
Chapter 5 Molecular Genetics
Evaluation | Q 6. | Page 87
Nootan Biology [English] Class 12 ISC
Chapter 6 Molecular Basis of Inheritance
Test Your Progress | Q 1. 29 | Page 264

RELATED QUESTIONS

How CO2 makes idlies puffy?


What is the correct sequence of the stages in bacteriophage lytic cycle?

(A) Attachment, Penetration, Lysis, Multiplication

(B) Attachment, Penetration, Multiplication, Lysis

(C) Lysis, Penetration, Multiplication, Attachment

(D) Attachment, Lysis, Multiplication, Penetration


What is Bacteriophage?


Very Short Answer Question:

When does DNA replication takes place?


Define Heterochromatin.


How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?


Describe the process of semiconservative replication of DNA with the help of a neat and labelled diagram.


E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?


a) Identify the figure given below

b) Redraw the structure as a replicating fork and label the parts


c) Write the source of energy for this replication and name the enzyme involved in this process.

d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.


Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?


Which of the following term correctly describes the movement of ribosome on the mRNA?


When the DNA molecule appears like inverted Y, it is ______


Extension of the plasma membrane in a prokaryotic cell is ______.


Match the following column.

Column - I Column - II
(A) DNA structure 1. Muller and stadder
(B) Semiconservative replication of DNA 2. Beadle and partum
(C) One gene-one enzyme theory 3. Watson and crick
(D) Induction of mutation 4. Massillon and stahl

During the replication of DNA, the separated strands are prevented from recoiling by using ______.


How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'


Torsional stress created during DNA replication is relieved by ______.


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×