Advertisements
Advertisements
Question
a) Identify the figure given below
b) Redraw the structure as a replicating fork and label the parts
c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
Advertisements
Solution
a) Replication fork
b)
c) Deoxy nucleotide, triphosphate acts as a energy source for replication. DNA polymerase is used for replication.
d) mRNA contacting information for protein synthesis will developed from DNA strand having polariy 5 ’ → 3 ’
RELATED QUESTIONS
Enlist the names of enzymes used in semiconservative replication of DNA?
Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.
Complementary strands of DNA molecule are (i) and bound by (ii).
E. coli, in which both the strands of DNA are labeled with 15N is transferred to 14N medium and allowed to replicate for three generations. What would be the number of hybrid DNA molecules in the third generation?
Which of the following term correctly describes the movement of ribosome on the mRNA?
Select the mis-matched pair.
Nucleolus is a major center for:
Wobble position means:
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Enzyme involved in synthesis of RNA primer.
