Advertisements
Advertisements
प्रश्न
a) Identify the figure given below
b) Redraw the structure as a replicating fork and label the parts
c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
Advertisements
उत्तर
a) Replication fork
b)
c) Deoxy nucleotide, triphosphate acts as a energy source for replication. DNA polymerase is used for replication.
d) mRNA contacting information for protein synthesis will developed from DNA strand having polariy 5 ’ → 3 ’
संबंधित प्रश्न
Long Answer Question:
Explain the process of DNA replication.
Differentiate between Leading stand and lagging strand.
Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.
In which direction polymerization of DNA nucleotides occurs during the synthesis of lagging strand?
Which of tbe following is generally used for creating density gradient during centrifugation?
______ carbon atoms of successive nucleotides of nucleic acid are linked by Phospho-diester bond.
Which of the following statement is incorrect?
Identify the biomolecule that is capable of self-replication.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
In prokaryotes, the primers of lagging strands are removed by ______.
