Advertisements
Advertisements
प्रश्न
E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?
विकल्प
One high and one low density band.
One intermediate density band.
One high and one intermediate density band.
One low and one intermediate density band.
Advertisements
उत्तर
One low and one intermediate density band.
Explanation:
This experiment follows the Meselson-Stahl model of semi-conservative replication. When E. coli cells grown in heavy 15N are moved to light 14N, the first generation produces “hybrid” DNA molecules containing one heavy and one light strand, resulting in a single intermediate density band. In the second generation, these hybrid strands serve as templates; the heavy strands again produce hybrids, while the light strands pair with new 14N to form entirely “light” DNA. This results in two distinct bands: one intermediate (hybrid) and one low-density (light), proving that DNA replicates by keeping one old strand and synthesising one new one.
APPEARS IN
संबंधित प्रश्न
______ enzymes are used as biological scissors in r-DNA technology.
What is the function of an RNA primer during protein synthesis?
What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?
Identify the direction of DNA replication in eukaryotes.
DNA replication begins at specific sites situated on the molecule. Such sites are called ____________.
For which of the following purpose agarose gel electrophoresis technique is used?
Complementary strands of DNA molecule are (i) and bound by (ii).
Which one of the following correctly represents the manner of replication of DNA?
In which direction polymerization of DNA nucleotides occurs during the synthesis of lagging strand?
Nucleolus is a major center for:
Extension of the plasma membrane in a prokaryotic cell is ______.
Which of the following reaction is required for proofreading during DNA replication by DNA polymerase III?
During the replication of DNA, the separated strands are prevented from recoiling by using ______.
The nucleic acid synthesis takes place in ______.
In viral DNA, how many origins of replication is/are present?
Characteristics unique to DNA are ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Which of the following DNA polymerase enzyme in eukaryotes has 5' -3' exonuclease activity?
Torsional stress created during DNA replication is relieved by ______.
