हिंदी

Meselson and Stahl’s experiment proved ______.

Advertisements
Advertisements

प्रश्न

Meselson and Stahl’s experiment proved ______.

विकल्प

  • Transduction

  • Transformation

  • DNA is the genetic material.

  • Semi-conservative nature of DNA replication.

MCQ
रिक्त स्थान भरें
Advertisements

उत्तर

Meselson and Stahl’s experiment proved Semi-conservative nature of DNA replication.

Explanation:

The Meselson and Stahl experiment (1958) definitively proved that DNA replication is semiconservative, meaning each new DNA molecule consists of one original parental strand and one newly synthesised strand. By growing E. coli bacteria in heavy nitrogen (15N) and then switching them to a medium with light nitrogen (14N), the researchers used density gradient centrifugation to observe the DNA’s weight over generations. They found that after one generation, all DNA was of intermediate density (a hybrid of heavy and light), and after two generations, half the DNA was hybrid and half was entirely light, which confirmed that the parent strands separate and serve as templates for new matching strands.

shaalaa.com
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
अध्याय 5: Molecular Genetics - Evaluation [पृष्ठ ८५]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 11. | पृष्ठ ८५
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 11. | पृष्ठ ८८
नूतन Biology [English] Class 12 ISC
अध्याय 5 Molecular Basis of Inheritance
TEST YOUR PROGRESS | Q 1. 115. | पृष्ठ २६८

संबंधित प्रश्न

Explain the semi-conservative replication of eukaryotic DNA.


As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.


Which enzyme does remove supercoils from replicating DNA?


A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?


What is the function of SSBP?


What are Okazaki fragments?


Differentiate between Leading stand and lagging strand.


a) Identify the figure given below

b) Redraw the structure as a replicating fork and label the parts


c) Write the source of energy for this replication and name the enzyme involved in this process.

d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.


______ heavy isotope was used by Meselson and Stahl during their experiment.


Enzyme ______ brings about the DNA unwinding by breaking weak hydrogen bonds in the vicinity of origin.


Which of tbe following is generally used for creating density gradient during centrifugation?


Wobble position means:


During replication of DNA Okazaki fragments are formed in the direction:


Okazaki segments are formed during ______.


In viral DNA, how many origins of replication is/are present?


Select the incorrect statement regarding DNA replication.


How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'


In prokaryotes, the primers of lagging strands are removed by ______.


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×