मराठी

Meselson and Stahl’s experiment proved ______.

Advertisements
Advertisements

प्रश्न

Meselson and Stahl’s experiment proved ______.

पर्याय

  • Transduction

  • Transformation

  • DNA is the genetic material.

  • Semi-conservative nature of DNA replication.

MCQ
रिकाम्या जागा भरा
Advertisements

उत्तर

Meselson and Stahl’s experiment proved Semi-conservative nature of DNA replication.

Explanation:

The Meselson and Stahl experiment (1958) definitively proved that DNA replication is semiconservative, meaning each new DNA molecule consists of one original parental strand and one newly synthesised strand. By growing E. coli bacteria in heavy nitrogen (15N) and then switching them to a medium with light nitrogen (14N), the researchers used density gradient centrifugation to observe the DNA’s weight over generations. They found that after one generation, all DNA was of intermediate density (a hybrid of heavy and light), and after two generations, half the DNA was hybrid and half was entirely light, which confirmed that the parent strands separate and serve as templates for new matching strands.

shaalaa.com
  या प्रश्नात किंवा उत्तरात काही त्रुटी आहे का?
पाठ 5: Molecular Genetics - Evaluation [पृष्ठ ८५]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
पाठ 5 Molecular Genetics
Evaluation | Q 11. | पृष्ठ ८५
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
पाठ 5 Molecular Genetics
Evaluation | Q 11. | पृष्ठ ८८
नूतन Biology [English] Class 12 ISC
पाठ 5 Molecular Basis of Inheritance
TEST YOUR PROGRESS | Q 1. 115. | पृष्ठ २६८

संबंधित प्रश्‍न

A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?


Define Heterochromatin.


How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?


Okasaki fragments are joined together by ______.


What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?


Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.


During DNA replication, Okazaki fragments are used to elongate ____________.


Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?


Enzyme ______ brings about the DNA unwinding by breaking weak hydrogen bonds in the vicinity of origin.


Select the mis-matched pair.


When the DNA molecule appears like inverted Y, it is ______


Okazaki segments are formed during ______.


Which of the following reaction is required for proofreading during DNA replication by DNA polymerase III?


Select the incorrect statement regarding DNA replication.


Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.


How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'


Enzyme involved in synthesis of RNA primer.


In eukaryotic organisms, replication of DNA occurs in ______.


Statement I - In prokaryotes, there is only replicon however in eukaryotes, these are several replicons in tandem.

Statement II - Two separated strands in a replicon of DNA are prevented from re-joining by helicase enzyme.

In light of above statements, choose the correct answer from the option given below.


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×