Advertisements
Advertisements
प्रश्न
Meselson and Stahl’s experiment proved ______.
पर्याय
Transduction
Transformation
DNA is the genetic material.
Semi-conservative nature of DNA replication.
Advertisements
उत्तर
Meselson and Stahl’s experiment proved Semi-conservative nature of DNA replication.
Explanation:
The Meselson and Stahl experiment (1958) definitively proved that DNA replication is semiconservative, meaning each new DNA molecule consists of one original parental strand and one newly synthesised strand. By growing E. coli bacteria in heavy nitrogen (15N) and then switching them to a medium with light nitrogen (14N), the researchers used density gradient centrifugation to observe the DNA’s weight over generations. They found that after one generation, all DNA was of intermediate density (a hybrid of heavy and light), and after two generations, half the DNA was hybrid and half was entirely light, which confirmed that the parent strands separate and serve as templates for new matching strands.
APPEARS IN
संबंधित प्रश्न
______ enzymes are used as biological scissors in r-DNA technology.
Explain the semi-conservative replication of eukaryotic DNA.
As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.
What is the function of an RNA primer during protein synthesis?
Very Short Answer Question:
When does DNA replication takes place?
A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?
How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?
Describe the process of semiconservative replication of DNA with the help of a neat and labelled diagram.
E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?
DNA replication begins at specific sites situated on the molecule. Such sites are called ____________.
Match Column I with Column II and select the correct option among the following.
| Column I | Column II | ||
| i. | DNA replication | a. | RNA polymerase |
| ii. | Translation | b. | DNA polymerase |
| iii. | Transcription | c. | Reverse transcriptase |
| iv. | Reverse transcription | d. | t-RNA- amino acid complex |
Which one of the following correctly represents the manner of replication of DNA?
Which of the following represents the autocatalytic functions of DNA?
Assertion (A): DNA replication is said to be semi-conservative.
Reason (R): After DNA replication, each daughter molecule has one old and one new strand.
Which of tbe following is generally used for creating density gradient during centrifugation?
In DNA molecule, pairing between two complementary nucleotides takes place by ________ bonds.
"DNA is considered as genetic material" - Why?
Match the following column.
| Column - I | Column - II |
| (A) DNA structure | 1. Muller and stadder |
| (B) Semiconservative replication of DNA | 2. Beadle and partum |
| (C) One gene-one enzyme theory | 3. Watson and crick |
| (D) Induction of mutation | 4. Massillon and stahl |
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Statement I - In prokaryotes, there is only replicon however in eukaryotes, these are several replicons in tandem.
Statement II - Two separated strands in a replicon of DNA are prevented from re-joining by helicase enzyme.
In light of above statements, choose the correct answer from the option given below.
