Advertisements
Advertisements
प्रश्न
Meselson and Stahl’s experiment proved ______.
पर्याय
Transduction
Transformation
DNA is the genetic material.
Semi-conservative nature of DNA replication.
Advertisements
उत्तर
Meselson and Stahl’s experiment proved Semi-conservative nature of DNA replication.
Explanation:
The Meselson and Stahl experiment (1958) definitively proved that DNA replication is semiconservative, meaning each new DNA molecule consists of one original parental strand and one newly synthesised strand. By growing E. coli bacteria in heavy nitrogen (15N) and then switching them to a medium with light nitrogen (14N), the researchers used density gradient centrifugation to observe the DNA’s weight over generations. They found that after one generation, all DNA was of intermediate density (a hybrid of heavy and light), and after two generations, half the DNA was hybrid and half was entirely light, which confirmed that the parent strands separate and serve as templates for new matching strands.
APPEARS IN
संबंधित प्रश्न
What is Bacteriophage?
What is the function of an RNA primer during protein synthesis?
Very Short Answer Question:
When does DNA replication takes place?
Identify the direction of DNA replication in eukaryotes.
Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.
Match Column I with Column II and select the correct option among the following.
| Column I | Column II | ||
| i. | DNA replication | a. | RNA polymerase |
| ii. | Translation | b. | DNA polymerase |
| iii. | Transcription | c. | Reverse transcriptase |
| iv. | Reverse transcription | d. | t-RNA- amino acid complex |
E. coli, in which both the strands of DNA are labeled with 15N is transferred to 14N medium and allowed to replicate for three generations. What would be the number of hybrid DNA molecules in the third generation?
When DNA directs the synthesis of chemical molecules other than itself, then such functions of DNA are known as ______.
Identify the CORRECT combination of statements with respect to DNA synthesis.
I. Always the direction of DNA polymerization 5' → 3' when referring to the polarity of strand being synthesized.
II. DNA ligase forms hydrogen bonds between two newly synthesized DNA strands.
III. DNA polymerases on their own cannot initiate the process of replication.
IV. DNA polymerase can catalyse polymerization in both 5'→ 3' and 3'→ 5' direction.
Which of the following is the function of single-strand binding proteins?
______ carbon atoms of successive nucleotides of nucleic acid are linked by Phospho-diester bond.
During replication of DNA Okazaki fragments are formed in the direction:
In viral DNA, how many origins of replication is/are present?
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?
In eukaryotic organisms, replication of DNA occurs in ______.
Which scientists first proposed the semi-conservative model of DNA replication based on the structure of the double helix?
Which experiment provided definitive proof that DNA replication is semi-conservative?
According to the conservative model of DNA replication, the original DNA double strand would:
