Advertisements
Advertisements
प्रश्न
The first codon to be deciphered was ______ which codes for ______.
पर्याय
AAA, proline
GGG, alanine
UUU, Phenylalanine
TTT, arginine
Advertisements
उत्तर
The first codon to be deciphered was UUU which codes for Phenylalanine.
Explanation:
APPEARS IN
संबंधित प्रश्न
Give an example of a codon having a dual function.
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
Differentiate between the genetic codes given below:
Degenerate and Initiator
Name the anticodon required to recognize the following codon: AAU.
Frame shift mutation occurs when ______.
The number of base substitution possible in amino acid codons is ______.
H. J. Muller was awarded Nobel Prize for his ______.
Some amino acids are coded by more than one codon, hence the genetic code is ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Which of the following organ is essential for photorespiration?
George Gamow suggested that each codon coding for an amino acid consists of ______
How many codons code for amino acid?
Frame shift mutations are caused by ______.
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Which one of the following is a termination codon?
