Advertisements
Advertisements
प्रश्न
The first codon to be deciphered was ______ which codes for ______.
पर्याय
AAA, proline
GGG, alanine
UUU, Phenylalanine
TTT, arginine
Advertisements
उत्तर
The first codon to be deciphered was UUU which codes for Phenylalanine.
Explanation:
APPEARS IN
संबंधित प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
One of the following is true with respect to AUG.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Which out of the following statements is incorrect?
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Select the incorrectly matched pair.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Percentage of mitochondrial DNA in the cell is:
Methionine carrying tRNA has anticodon:
Frame shift mutations are caused by ______.
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
How many amino acids can be coded by a doublet codon system?
How many codons in total exist in the genetic code?
Which of the following statements about stop codons is correct?
What is the start codon and which amino acid does it code for?
Which scientist developed a method for synthesizing RNA molecules with repeated known nucleotide sequences to help decipher the genetic code?
