Advertisements
Advertisements
प्रश्न
The first codon to be deciphered was ______ which codes for ______.
पर्याय
AAA, proline
GGG, alanine
UUU, Phenylalanine
TTT, arginine
Advertisements
उत्तर
The first codon to be deciphered was UUU which codes for Phenylalanine.
Explanation:
APPEARS IN
संबंधित प्रश्न
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
Differentiate between the genetic codes given below:
Unambiguous and Universal
Differentiate between the genetic codes given below:
Degenerate and Initiator
One of the following is true with respect to AUG.
H. J. Muller was awarded Nobel Prize for his ______.
Some amino acids are coded by more than one codon, hence the genetic code is ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Select the incorrectly matched pair.
Phenylalanine is a ______.
Percentage of mitochondrial DNA in the cell is:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
George Gamow suggested that each codon coding for an amino acid consists of ______
Genetic code is universal, it means ______
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Which of the following statements is the most appropriate for sickle cell anaemia?
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
