मराठी

The first codon to be deciphered was ______ which codes for ______. - Biology (Theory)

Advertisements
Advertisements

प्रश्न

The first codon to be deciphered was ______ which codes for ______.

पर्याय

  • AAA, proline

  • GGG, alanine

  • UUU, Phenylalanine

  • TTT, arginine

MCQ
रिकाम्या जागा भरा
Advertisements

उत्तर

The first codon to be deciphered was UUU which codes for Phenylalanine.

Explanation:

In 1961, Marshall Nirenberg and Heinrich Matthaei performed a groundbreaking experiment to begin “cracking” the genetic code. They used a synthetic poly-U RNA strand (made entirely of Uracil bases) in a cell-free system. They discovered that this UUU message led to the creation of a protein chain consisting solely of the amino acid phenylalanine. This was the first time a specific codon was successfully matched to a specific amino acid, marking a massive milestone in molecular biology.
shaalaa.com
  या प्रश्नात किंवा उत्तरात काही त्रुटी आहे का?
पाठ 5: Molecular Genetics - Evaluation [पृष्ठ ८५]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
पाठ 5 Molecular Genetics
Evaluation | Q 10. | पृष्ठ ८५
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
पाठ 5 Molecular Genetics
Evaluation | Q 10. | पृष्ठ ८८
नूतन Biology [English] Class 12 ISC
पाठ 6 Molecular Basis of Inheritance
Test Your Progress | Q 1. 82. | पृष्ठ २६७

संबंधित प्रश्‍न

Give an example of a codon having dual function.


Answer the following question.
State the importance of a Genetic code in protein biosynthesis.


Name the anticodon required to recognize the following codon: UAU


One of the following is true with respect to AUG.


Frame shift mutation occurs when ______.


Because most of the amino acids are represented by more than one codon, the genetic code is ______.


The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.


Select the incorrectly matched pair.


Genetic code was discovered by:


George Gamow suggested that each codon coding for an amino acid consists of ______


Frame shift mutations are caused by ______.


Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.

In the light of the above statements, choose the correct answer from the options given below.


Statement I:

The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II:

‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.

In light of the above statements, choose the correct answer from the options given below.


Which of the following statements is the most appropriate for sickle cell anaemia?


There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.


Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'


Which one of the following is a termination codon?


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×