Advertisements
Advertisements
प्रश्न
Differentiate between the genetic codes given below:
Unambiguous and Universal
Advertisements
उत्तर
Unambiguous and Universal:
| Unambiguous | Universal: |
|
The code is specific, i.e. one condon codes for only one amino acid. |
The code is the same in all organisms. |
APPEARS IN
संबंधित प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Degenerate and Initiator
The first codon to be deciphered was __________ which codes for ________.
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: AAU.
One of the following is true with respect to AUG.
Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
