Advertisements
Advertisements
प्रश्न
Differentiate between the genetic codes given below:
Unambiguous and Universal
Advertisements
उत्तर
Unambiguous and Universal:
| Unambiguous | Universal: |
|
The code is specific, i.e. one condon codes for only one amino acid. |
The code is the same in all organisms. |
APPEARS IN
संबंधित प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Degenerate and Initiator
Name the anticodon required to recognize the following codon: GCA.
Frame shift mutation occurs when ______.
The number of base substitution possible in amino acid codons is ______.
Amino acids which are specified by single codons are ______.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Which of the following sets of codons all code for the same amino acid, demonstrating degeneracy?
