Advertisements
Advertisements
प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Advertisements
उत्तर
George Gamow proposed that if 20 amino acids are to be coded by 4 bases, then the code should be made up of three nucleotides.
43 = 64 (42 = 16), which is less than 20; so, the codon was proposed to be a triplet.
Har Gobind Khorana developed a chemical method to synthesize RNA molecules with a defined combination of bases.
Marshall Nirenberg developed cell-free systems for protein synthesis, which helped the code to be deciphered.
Severo Ochoa discovered an enzyme (polynucleotide phosphorylase) which helped in the synthesis of RNA with defined sequences in a template-independent manner.
संबंधित प्रश्न
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
Amino acids which are specified by single codons are ______.
Which out of the following statements is incorrect?
Select the incorrectly matched pair.
Which of the following organ is essential for photorespiration?
George Gamow suggested that each codon coding for an amino acid consists of ______
Genetic code is universal, it means ______
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
All the 64 codons in the dictionary of genetic code were deciphered by ______.
