Advertisements
Advertisements
प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Advertisements
उत्तर
George Gamow proposed that if 20 amino acids are to be coded by 4 bases, then the code should be made up of three nucleotides.
43 = 64 (42 = 16), which is less than 20; so, the codon was proposed to be a triplet.
Har Gobind Khorana developed a chemical method to synthesize RNA molecules with a defined combination of bases.
Marshall Nirenberg developed cell-free systems for protein synthesis, which helped the code to be deciphered.
Severo Ochoa discovered an enzyme (polynucleotide phosphorylase) which helped in the synthesis of RNA with defined sequences in a template-independent manner.
संबंधित प्रश्न
The first codon to be deciphered was __________ which codes for ________.
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: UAU
H. J. Muller was awarded Nobel Prize for his ______.
Which out of the following statements is incorrect?
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
George Gamow suggested that each codon coding for an amino acid consists of ______
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Which of the following statements is the most appropriate for sickle cell anaemia?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
