Advertisements
Advertisements
प्रश्न
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct?
Advertisements
उत्तर
The statement is correct. Because of degeneracy of codons, mutations at third base of codon, usually does not result into any change in phenotype. This is called silent mutations.
Notes
Students should refer to the answer according to their questions.
APPEARS IN
संबंधित प्रश्न
Give an example of a codon having a dual function.
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Unambiguous and Universal
The first codon to be deciphered was ______ which codes for ______.
Name the anticodon required to recognize the following codon: CGA
One of the following is true with respect to AUG.
Khorana first deciphered the triplet codons of ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Which out of the following statements is incorrect?
Some amino acids are coded by more than one codon, hence the genetic code is ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Select the incorrectly matched pair.
Which of the following organ is essential for photorespiration?
Phenylalanine is a ______.
Percentage of mitochondrial DNA in the cell is:
Methionine carrying tRNA has anticodon:
Genetic code was discovered by:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
George Gamow suggested that each codon coding for an amino acid consists of ______
Which amino acid is determined by four genetic codes?
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
