Advertisements
Advertisements
प्रश्न
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct?
Advertisements
उत्तर
The statement is correct. Because of degeneracy of codons, mutations at third base of codon, usually does not result into any change in phenotype. This is called silent mutations.
Notes
Students should refer to the answer according to their questions.
APPEARS IN
संबंधित प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Degenerate and Initiator
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: CGA
One of the following is true with respect to AUG.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
H. J. Muller was awarded Nobel Prize for his ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
Which of the following organ is essential for photorespiration?
Phenylalanine is a ______.
Percentage of mitochondrial DNA in the cell is:
Genetic code translates the language of:
Genetic code was discovered by:
How many codons code for amino acid?
Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Which of the following statements is the most appropriate for sickle cell anaemia?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
What is the start codon and which amino acid does it code for?
Which scientist proved the triplet nature of the genetic code through frame-shift mutation experiments in 1961?
Which enzyme did Severo Ochoa identify as capable of polymerizing RNA with defined sequences in a template-independent manner?
What is the wobble effect in the context of the genetic code?
Which three scientists are credited with ultimately deciphering all 64 codons of the genetic code dictionary?
