मराठी
कर्नाटक बोर्ड पी.यू.सी.पीयूसी विज्ञान 2nd PUC Class 12

A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer. - Biology

Advertisements
Advertisements

प्रश्न

A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.

A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct?

अति संक्षिप्त उत्तर
Advertisements

उत्तर

The statement is correct. Because of degeneracy of codons, mutations at third base of codon, usually does not result into any change in phenotype. This is called silent mutations.

shaalaa.com

Notes

Students should refer to the answer according to their questions.

  या प्रश्नात किंवा उत्तरात काही त्रुटी आहे का?
पाठ 6: Molecular Basis of Inheritance - SHORT ANSWER [पृष्ठ ४२]

APPEARS IN

एनसीईआरटी एक्झांप्लर Biology [English] Class 12
पाठ 6 Molecular Basis of Inheritance
SHORT ANSWER | Q 13. | पृष्ठ ४२
नूतन Biology [English] Class 12 ISC
पाठ 5 Principles of Inheritance and Variation
HIGHER ORDER THINKING SKILLS QUESTIONS | Q 27. | पृष्ठ २११

संबंधित प्रश्‍न

Give an example of a codon having a dual function.


Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa


Answer the following question.
State the importance of a Genetic code in protein biosynthesis.


Differentiate between the genetic codes given below:
Degenerate and Initiator


The first codon to be deciphered was ______ which codes for ______.


Name the anticodon required to recognize the following codon: GCA.


Khorana first deciphered the triplet codons of ______.


The number of base substitution possible in amino acid codons is ______.


Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.


H. J. Muller was awarded Nobel Prize for his ______.


Which out of the following statements is incorrect?


Some amino acids are coded by more than one codon, hence the genetic code is ______.


Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.


If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.


AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids: 

  Site A Site B
A. UAC Methionine
B. Methionine UAC
C. Methionine AUG
D. AUG Methionine

Which of the following organ is essential for photorespiration?


Percentage of mitochondrial DNA in the cell is:


Genetic code translates the language of:


Methionine carrying tRNA has anticodon:


Which amino acid is determined by four genetic codes?


Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.

In the light of the above statements, choose the correct answer from the options given below.


Which of the following statements is the most appropriate for sickle cell anaemia?


Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?


Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'


Which one of the following is a termination codon?


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×