हिंदी
कर्नाटक बोर्ड पी.यू.सी.पीयूसी विज्ञान 2nd PUC Class 12

A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.

Advertisements
Advertisements

प्रश्न

A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.

A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct?

अति संक्षिप्त उत्तर
Advertisements

उत्तर

The statement is correct. Because of degeneracy of codons, mutations at third base of codon, usually does not result into any change in phenotype. This is called silent mutations.

shaalaa.com

Notes

Students should refer to the answer according to their questions.

  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
अध्याय 6: Molecular Basis of Inheritance - SHORT ANSWER [पृष्ठ ४२]

APPEARS IN

एनसीईआरटी एक्झांप्लर Biology Exemplar [English] Class 12
अध्याय 6 Molecular Basis of Inheritance
SHORT ANSWER | Q 13. | पृष्ठ ४२
नूतन Biology [English] Class 12 ISC
अध्याय 4 Principles of Inheritance and Variation
HIGHER ORDER THINKING SKILLS QUESTIONS | Q 27. | पृष्ठ २११

संबंधित प्रश्न

Answer the following question.
State the importance of a Genetic code in protein biosynthesis.


Differentiate between the genetic codes given below:
Unambiguous and Universal


Differentiate between the genetic codes given below:
Degenerate and Initiator


Give reasons:

Genetic code is ‘universal’.


Name the anticodon required to recognize the following codon: UAU


DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?


Frame shift mutation occurs when ______.


Khorana first deciphered the triplet codons of ______.


Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.


The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.


Amino acids which are specified by single codons are ______.


Which out of the following statements is incorrect?


Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.


If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.


AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids: 

  Site A Site B
A. UAC Methionine
B. Methionine UAC
C. Methionine AUG
D. AUG Methionine

Percentage of mitochondrial DNA in the cell is:


Genetic code translates the language of:


Genetic code was discovered by:


What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?


Genetic code is universal, it means ______


Which amino acid is determined by four genetic codes?


Frame shift mutations are caused by ______.


Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.

In the light of the above statements, choose the correct answer from the options given below.


Statement I:

The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II:

‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.

In light of the above statements, choose the correct answer from the options given below.


Discuss the process of translation in detail.


Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'


Who proposed that the genetic code for amino acids should be made up of three nucleotides?


All the 64 codons in the dictionary of genetic code were deciphered by ______.


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×