Advertisements
Advertisements
प्रश्न
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct?
Advertisements
उत्तर
The statement is correct. Because of degeneracy of codons, mutations at third base of codon, usually does not result into any change in phenotype. This is called silent mutations.
Notes
Students should refer to the answer according to their questions.
APPEARS IN
संबंधित प्रश्न
Differentiate between the genetic codes given below:
Unambiguous and Universal
The first codon to be deciphered was ______ which codes for ______.
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: GCA.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Amino acids which are specified by single codons are ______.
Which out of the following statements is incorrect?
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Percentage of mitochondrial DNA in the cell is:
Methionine carrying tRNA has anticodon:
Genetic code was discovered by:
Genetic code is universal, it means ______
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
All the 64 codons in the dictionary of genetic code were deciphered by ______.
How many amino acids can be coded by a doublet codon system?
How many codons in total exist in the genetic code?
Which of the following statements about stop codons is correct?
Which scientist proved the triplet nature of the genetic code through frame-shift mutation experiments in 1961?
Which of the following sets of codons all code for the same amino acid, demonstrating degeneracy?
How many codons code for amino acids and how many are stop codons?
