Advertisements
Advertisements
Questions
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct?
Advertisements
Solution
The statement is correct. Because of degeneracy of codons, mutations at third base of codon, usually does not result into any change in phenotype. This is called silent mutations.
Notes
Students should refer to the answer according to their questions.
APPEARS IN
RELATED QUESTIONS
The first codon to be deciphered was ______ which codes for ______.
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: UAU
Genetic code is ______.
Khorana first deciphered the triplet codons of ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
Phenylalanine is a ______.
Percentage of mitochondrial DNA in the cell is:
Genetic code translates the language of:
Genetic code was discovered by:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
George Gamow suggested that each codon coding for an amino acid consists of ______
How many codons code for amino acid?
Frame shift mutations are caused by ______.
Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
