Advertisements
Advertisements
Question
The first codon to be deciphered was ______ which codes for ______.
Options
AAA, proline
GGG, alanine
UUU, Phenylalanine
TTT, arginine
Advertisements
Solution
The first codon to be deciphered was UUU which codes for Phenylalanine.
Explanation:
APPEARS IN
RELATED QUESTIONS
Give an example of a codon having dual function.
Differentiate between the genetic codes given below:
Unambiguous and Universal
Differentiate between the genetic codes given below:
Degenerate and Initiator
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: GCA.
Genetic code is ______.
Khorana first deciphered the triplet codons of ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Some amino acids are coded by more than one codon, hence the genetic code is ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Genetic code was discovered by:
Genetic code is universal, it means ______
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Which of the following statements is the most appropriate for sickle cell anaemia?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
