Advertisements
Advertisements
प्रश्न
The first codon to be deciphered was ______ which codes for ______.
विकल्प
AAA, proline
GGG, alanine
UUU, Phenylalanine
TTT, arginine
Advertisements
उत्तर
The first codon to be deciphered was UUU which codes for Phenylalanine.
Explanation:
APPEARS IN
संबंधित प्रश्न
Give reasons:
Genetic code is ‘universal’.
One of the following is true with respect to AUG.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Genetic code is ______.
Frame shift mutation occurs when ______.
The number of base substitution possible in amino acid codons is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
Which out of the following statements is incorrect?
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Percentage of mitochondrial DNA in the cell is:
Genetic code translates the language of:
George Gamow suggested that each codon coding for an amino acid consists of ______
Frame shift mutations are caused by ______.
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Which of the following statements is the most appropriate for sickle cell anaemia?
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
