Advertisements
Advertisements
प्रश्न
The first codon to be deciphered was ______ which codes for ______.
विकल्प
AAA, proline
GGG, alanine
UUU, Phenylalanine
TTT, arginine
Advertisements
उत्तर
The first codon to be deciphered was UUU which codes for Phenylalanine.
Explanation:
APPEARS IN
संबंधित प्रश्न
Differentiate between the genetic codes given below:
Degenerate and Initiator
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: UAU
One of the following is true with respect to AUG.
Genetic code is ______.
Frame shift mutation occurs when ______.
Khorana first deciphered the triplet codons of ______.
The number of base substitution possible in amino acid codons is ______.
Amino acids which are specified by single codons are ______.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Genetic code is universal, it means ______
How many codons code for amino acid?
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Which one of the following is a termination codon?
