हिंदी

The first codon to be deciphered was ______ which codes for ______. - Biology (Theory)

Advertisements
Advertisements

प्रश्न

The first codon to be deciphered was ______ which codes for ______.

विकल्प

  • AAA, proline

  • GGG, alanine

  • UUU, Phenylalanine

  • TTT, arginine

MCQ
रिक्त स्थान भरें
Advertisements

उत्तर

The first codon to be deciphered was UUU which codes for Phenylalanine.

Explanation:

In 1961, Marshall Nirenberg and Heinrich Matthaei performed a groundbreaking experiment to begin “cracking” the genetic code. They used a synthetic poly-U RNA strand (made entirely of Uracil bases) in a cell-free system. They discovered that this UUU message led to the creation of a protein chain consisting solely of the amino acid phenylalanine. This was the first time a specific codon was successfully matched to a specific amino acid, marking a massive milestone in molecular biology.
shaalaa.com
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
अध्याय 5: Molecular Genetics - Evaluation [पृष्ठ ८५]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 10. | पृष्ठ ८५
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 10. | पृष्ठ ८८
नूतन Biology [English] Class 12 ISC
अध्याय 6 Molecular Basis of Inheritance
Test Your Progress | Q 1. 82. | पृष्ठ २६७

संबंधित प्रश्न

Give an example of a codon having dual function.


One of the following is true with respect to AUG.


DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?


Frame shift mutation occurs when ______.


Some amino acids are coded by more than one codon, hence the genetic code is ______.


Which of the following organ is essential for photorespiration?


Phenylalanine is a ______.


Genetic code translates the language of:


Methionine carrying tRNA has anticodon:


George Gamow suggested that each codon coding for an amino acid consists of ______


Genetic code is universal, it means ______


Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.

In the light of the above statements, choose the correct answer from the options given below.


Which of the following statements is the most appropriate for sickle cell anaemia?


Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?


There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.


Discuss the process of translation in detail.


Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×