Advertisements
Advertisements
प्रश्न
The first codon to be deciphered was ______ which codes for ______.
विकल्प
AAA, proline
GGG, alanine
UUU, Phenylalanine
TTT, arginine
Advertisements
उत्तर
The first codon to be deciphered was UUU which codes for Phenylalanine.
Explanation:
APPEARS IN
संबंधित प्रश्न
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: AAU.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Khorana first deciphered the triplet codons of ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Which out of the following statements is incorrect?
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Which of the following organ is essential for photorespiration?
Genetic code was discovered by:
Which amino acid is determined by four genetic codes?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
All the 64 codons in the dictionary of genetic code were deciphered by ______.
According to George Gamow's proposal from 1954, why is the genetic code a triplet code?
What is the start codon and which amino acid does it code for?
Which of the following sets of codons all code for the same amino acid, demonstrating degeneracy?
What is the wobble effect in the context of the genetic code?
Which three scientists are credited with ultimately deciphering all 64 codons of the genetic code dictionary?
