Advertisements
Advertisements
प्रश्न
Which of the following statements is not true about DNA replication in eukaryotes?
विकल्प
Replication begins at a single origin of replication.
Replication is bidirectional from the origins.
Replication occurs at about 1 million base pairs per minute.
There are numerous different bacterial chromosomes, with replication ocurring in each at the same time.
Advertisements
उत्तर
There are numerous different bacterial chromosomes, with replication ocurring in each at the same time.
संबंधित प्रश्न
Very Short Answer Question:
When does DNA replication takes place?
Semiconservative mechanism of DNA was detected using:
E. coli, in which both the strands of DNA are labeled with 15N is transferred to 14N medium and allowed to replicate for three generations. What would be the number of hybrid DNA molecules in the third generation?
Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?
Assertion (A): DNA replication is said to be semi-conservative.
Reason (R): After DNA replication, each daughter molecule has one old and one new strand.
"DNA is considered as genetic material" - Why?
Match the following column.
| Column - I | Column - II |
| (A) DNA structure | 1. Muller and stadder |
| (B) Semiconservative replication of DNA | 2. Beadle and partum |
| (C) One gene-one enzyme theory | 3. Watson and crick |
| (D) Induction of mutation | 4. Massillon and stahl |
Select the incorrect statement regarding DNA replication.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Which of the following statement is correct regarding the process of replication in E.coli?
