Advertisements
Advertisements
प्रश्न
Which of the following statements about DNA replication is not correct?
विकल्प
Unwinding of DNA molecule occurs as hydrogen bonds break.
Replication occurs as each base is paired with another exactly like it.
Process is known as semi conservative replication because one old strand is conserved in the new molecule.
Complementary base pairs are held together with hydrogen bonds.
Advertisements
उत्तर
Replication occurs as each base is paired with another exactly like it.
Explanation:
DNA replication does not pair identical bases together; instead, it follows the rule of complementary base pairing. This means an Adenine (A) on the original strand always pairs with a Thymine (T) on the new strand, and a Guanine (G) always pairs with a Cytosine (C). The other statements are correct: the double helix must unwind by breaking hydrogen bonds, the process is semiconservative since each new molecule keeps one original strand, and hydrogen bonds are indeed what hold the new base pairs together.
APPEARS IN
संबंधित प्रश्न
How CO2 makes idlies puffy?
What is Bacteriophage?
Long Answer Question:
Explain the process of DNA replication.
During DNA replication, the separated strands of DNA are prevented from recoiling by
Which of the following statements is not true about DNA replication in eukaryotes?
Identify the direction of DNA replication in eukaryotes.
Read the following statements and select the correct option.
i. The unit of DNA in which replication occurs, is called replicon.
ii. In eukaryotes, there is only one replicon however in prokaryotes there are several replicons in tandem.
Complementary strands of DNA molecule are (i) and bound by (ii).
Enzyme ______ brings about the DNA unwinding by breaking weak hydrogen bonds in the vicinity of origin.
Which of the following term correctly describes the movement of ribosome on the mRNA?
In DNA molecule, pairing between two complementary nucleotides takes place by ________ bonds.
When the DNA molecule appears like inverted Y, it is ______
Nucleolus is a major center for:
Which of the following statement is incorrect?
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Enzyme involved in synthesis of RNA primer.
In eukaryotic organisms, replication of DNA occurs in ______.
Which phase of the cell cycle is DNA replication primarily restricted to?
In the dispersive model of DNA replication, both strands of both daughter DNA molecules would consist of:
