हिंदी

What is Bacteriophage?

Advertisements
Advertisements

प्रश्न

What is Bacteriophage?

एक पंक्ति में उत्तर
Advertisements

उत्तर

Bacteriophage is the virus that infects the bacteria and injects the bacterium with its genetic material.

shaalaa.com
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
2015-2016 (July)

संबंधित प्रश्न

As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.


E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?


Which of the following statements about DNA replication is not correct?


a) Identify the figure given below

b) Redraw the structure as a replicating fork and label the parts


c) Write the source of energy for this replication and name the enzyme involved in this process.

d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.


Read the following statements and select the correct option.

i. The unit of DNA in which replication occurs, is called replicon.

ii. In eukaryotes, there is only one replicon however in prokaryotes there are several replicons in tandem.


In which direction polymerization of DNA nucleotides occurs during the synthesis of lagging strand?


Which of the following is the function of single-strand binding proteins?


Which of the following reaction is required for proofreading during DNA replication by DNA polymerase III?


The nucleic acid synthesis takes place in ______.


How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×