Advertisements
Advertisements
Question
Which of the following statements about DNA replication is not correct?
Options
Unwinding of DNA molecule occurs as hydrogen bonds break.
Replication occurs as each base is paired with another exactly like it.
Process is known as semi conservative replication because one old strand is conserved in the new molecule.
Complementary base pairs are held together with hydrogen bonds.
Advertisements
Solution
Replication occurs as each base is paired with another exactly like it.
Explanation:
DNA replication does not pair identical bases together; instead, it follows the rule of complementary base pairing. This means an Adenine (A) on the original strand always pairs with a Thymine (T) on the new strand, and a Guanine (G) always pairs with a Cytosine (C). The other statements are correct: the double helix must unwind by breaking hydrogen bonds, the process is semiconservative since each new molecule keeps one original strand, and hydrogen bonds are indeed what hold the new base pairs together.
APPEARS IN
RELATED QUESTIONS
Explain replication of bacteriophage with the help of a suitable diagram.
Very Short Answer Question:
Why are Okazaki fragments formed on lagging strand only?
During DNA replication, the separated strands of DNA are prevented from recoiling by
Define Heterochromatin.
What are Okazaki fragments?
Meselson and Stahl’s experiment proved ______.
a) Identify the figure given below
b) Redraw the structure as a replicating fork and label the parts
c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
Match Column I with Column II and select the correct option among the following.
| Column I | Column II | ||
| i. | DNA replication | a. | RNA polymerase |
| ii. | Translation | b. | DNA polymerase |
| iii. | Transcription | c. | Reverse transcriptase |
| iv. | Reverse transcription | d. | t-RNA- amino acid complex |
Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?
Which of the following is present at the sticky ends of a fragmented DNA molecule?
In DNA molecule, pairing between two complementary nucleotides takes place by ________ bonds.
Select the mis-matched pair.
When the DNA molecule appears like inverted Y, it is ______
Okazaki segments are formed during ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Torsional stress created during DNA replication is relieved by ______.
Which of the following statement is correct regarding the process of replication in E.coli?
Statement I - In prokaryotes, there is only replicon however in eukaryotes, these are several replicons in tandem.
Statement II - Two separated strands in a replicon of DNA are prevented from re-joining by helicase enzyme.
In light of above statements, choose the correct answer from the option given below.
