Advertisements
Advertisements
Question
Which of the following statements about DNA replication is not correct?
Options
Unwinding of DNA molecule occurs as hydrogen bonds break.
Replication occurs as each base is paired with another exactly like it.
Process is known as semi conservative replication because one old strand is conserved in the new molecule.
Complementary base pairs are held together with hydrogen bonds.
Advertisements
Solution
Replication occurs as each base is paired with another exactly like it.
Explanation:
DNA replication does not pair identical bases together; instead, it follows the rule of complementary base pairing. This means an Adenine (A) on the original strand always pairs with a Thymine (T) on the new strand, and a Guanine (G) always pairs with a Cytosine (C). The other statements are correct: the double helix must unwind by breaking hydrogen bonds, the process is semiconservative since each new molecule keeps one original strand, and hydrogen bonds are indeed what hold the new base pairs together.
APPEARS IN
RELATED QUESTIONS
What is the function of an RNA primer during protein synthesis?
A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?
Enlist the names of enzymes used in semiconservative replication of DNA?
Define Heterochromatin.
How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?
What are Okazaki fragments?
What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?
Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.
Complementary strands of DNA molecule are (i) and bound by (ii).
Which one of the following correctly represents the manner of replication of DNA?
Which of the following is present at the sticky ends of a fragmented DNA molecule?
Which one of the following can form a nucleotide of DNA?
In a segment of DNA with 10 base pairs, the numbers of sugar molecules are _________.
During replication of DNA Okazaki fragments are formed in the direction:
Identify the biomolecule that is capable of self-replication.
In viral DNA, how many origins of replication is/are present?
Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
In the dispersive model of DNA replication, both strands of both daughter DNA molecules would consist of:
