Advertisements
Advertisements
Question
What background information did Watson and Crick had available with them for developing a model of DNA? What was their own contribution?
Advertisements
Solution
Wastson and Crick had the following informations which helped them to develop a model of DNA.
- Chargaffs’ Law suggesting A = T, and C = G.
- Wilkins and Rosalind Franklin’s work on DNA crystal’s X-ray diffraction studies about DNA’s physical structure.
- Watson and crick proposed
- How complementary bases may pair
- Semi-conservative replication and
- Mutation through tautomerism
APPEARS IN
RELATED QUESTIONS
What is the correct sequence of the stages in bacteriophage lytic cycle?
(A) Attachment, Penetration, Lysis, Multiplication
(B) Attachment, Penetration, Multiplication, Lysis
(C) Lysis, Penetration, Multiplication, Attachment
(D) Attachment, Lysis, Multiplication, Penetration
Which enzyme does remove supercoils from replicating DNA?
Long Answer Question:
Explain the process of DNA replication.
How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?
Which of the following statements about DNA replication is not correct?
Which of the following statements is not true about DNA replication in eukaryotes?
a) Identify the figure given below
b) Redraw the structure as a replicating fork and label the parts

c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
Match Column I with Column II and select the correct option among the following.
| Column I | Column II | ||
| i. | DNA replication | a. | RNA polymerase |
| ii. | Translation | b. | DNA polymerase |
| iii. | Transcription | c. | Reverse transcriptase |
| iv. | Reverse transcription | d. | t-RNA- amino acid complex |
Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?
Assertion (A): DNA replication is said to be semi-conservative.
Reason (R): After DNA replication, each daughter molecule has one old and one new strand.
Nucleolus is a major center for:
Which of the following statement is incorrect?
During the replication of DNA, the separated strands are prevented from recoiling by using ______.
In viral DNA, how many origins of replication is/are present?
Characteristics unique to DNA are ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Which of the following DNA polymerase enzyme in eukaryotes has 5' -3' exonuclease activity?
Torsional stress created during DNA replication is relieved by ______.
Which of the following statement is correct regarding the process of replication in E.coli?
