Advertisements
Advertisements
प्रश्न
What background information did Watson and Crick had available with them for developing a model of DNA? What was their own contribution?
Advertisements
उत्तर
Wastson and Crick had the following informations which helped them to develop a model of DNA.
- Chargaffs’ Law suggesting A = T, and C = G.
- Wilkins and Rosalind Franklin’s work on DNA crystal’s X-ray diffraction studies about DNA’s physical structure.
- Watson and crick proposed
- How complementary bases may pair
- Semi-conservative replication and
- Mutation through tautomerism
APPEARS IN
संबंधित प्रश्न
Explain the semi-conservative replication of eukaryotic DNA.
Very Short Answer Question:
Why are Okazaki fragments formed on lagging strand only?
A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?
Draw neat and labelled diagram of Replication Fork.
What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?
From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability, and mutation?
Match Column I with Column II and select the correct option among the following.
| Column I | Column II | ||
| i. | DNA replication | a. | RNA polymerase |
| ii. | Translation | b. | DNA polymerase |
| iii. | Transcription | c. | Reverse transcriptase |
| iv. | Reverse transcription | d. | t-RNA- amino acid complex |
Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?
Which of the following term correctly describes the movement of ribosome on the mRNA?
Which of tbe following is generally used for creating density gradient during centrifugation?
When the DNA molecule appears like inverted Y, it is ______
Characteristics unique to DNA are ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Which of the following DNA polymerase enzyme in eukaryotes has 5' -3' exonuclease activity?
In prokaryotes, the primers of lagging strands are removed by ______.
Torsional stress created during DNA replication is relieved by ______.
Enzyme involved in synthesis of RNA primer.
In eukaryotic organisms, replication of DNA occurs in ______.
Statement I - In prokaryotes, there is only replicon however in eukaryotes, these are several replicons in tandem.
Statement II - Two separated strands in a replicon of DNA are prevented from re-joining by helicase enzyme.
In light of above statements, choose the correct answer from the option given below.
According to the conservative model of DNA replication, the original DNA double strand would:
