Advertisements
Advertisements
प्रश्न
What background information did Watson and Crick had available with them for developing a model of DNA? What was their own contribution?
Advertisements
उत्तर
Wastson and Crick had the following informations which helped them to develop a model of DNA.
- Chargaffs’ Law suggesting A = T, and C = G.
- Wilkins and Rosalind Franklin’s work on DNA crystal’s X-ray diffraction studies about DNA’s physical structure.
- Watson and crick proposed
- How complementary bases may pair
- Semi-conservative replication and
- Mutation through tautomerism
APPEARS IN
संबंधित प्रश्न
How CO2 makes idlies puffy?
What is the function of an RNA primer during protein synthesis?
Which enzyme does remove supercoils from replicating DNA?
Very Short Answer Question:
When does DNA replication takes place?
A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?
What is the function of SSBP?
Define Heterochromatin.
Draw neat and labelled diagram of Replication Fork.
Describe the process of semiconservative replication of DNA with the help of a neat and labelled diagram.
Meselson and Stahl’s experiment proved ______.
Differentiate between Leading stand and lagging strand.
a) Identify the figure given below
b) Redraw the structure as a replicating fork and label the parts
c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.
During DNA replication, Okazaki fragments are used to elongate ____________.
For which of the following reason RNA primer is must for initiation of DNA replication?
Which of the following is the function of single-strand binding proteins?
Identify the biomolecule that is capable of self-replication.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Torsional stress created during DNA replication is relieved by ______.
