Advertisements
Advertisements
प्रश्न
From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability, and mutation?
Advertisements
उत्तर
Inference of Watson and Crick on DNA replication:
They concluded that each of the DNA strand in a helix act as template during DNA replication leading to formation of new daughter DNA molecules, which are complementary to parental strand, (i.e., Semi-conservative method of replication).
Inference on coding capability:
During transcription, the genetic information in the DNA strand is coded to mRNA as complementary bases, (except for uracil in place of thymine in RNA).
Inference on mutation:
Any changes in the nucleotide sequence of DNA leads to corresponding alteration in aminoacid sequence of specific protein thus confirming the validity of genetic code.
संबंधित प्रश्न
Long Answer Question:
Explain the process of DNA replication.
A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?
Draw neat and labelled diagram of Replication Fork.
How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?
Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.
Read the following statements and select the correct option.
i. The unit of DNA in which replication occurs, is called replicon.
ii. In eukaryotes, there is only one replicon however in prokaryotes there are several replicons in tandem.
When the DNA molecule appears like inverted Y, it is ______
Characteristics unique to DNA are ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Torsional stress created during DNA replication is relieved by ______.
