Advertisements
Advertisements
प्रश्न
From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability, and mutation?
Advertisements
उत्तर
Inference of Watson and Crick on DNA replication:
They concluded that each of the DNA strand in a helix act as template during DNA replication leading to formation of new daughter DNA molecules, which are complementary to parental strand, (i.e., Semi-conservative method of replication).
Inference on coding capability:
During transcription, the genetic information in the DNA strand is coded to mRNA as complementary bases, (except for uracil in place of thymine in RNA).
Inference on mutation:
Any changes in the nucleotide sequence of DNA leads to corresponding alteration in aminoacid sequence of specific protein thus confirming the validity of genetic code.
संबंधित प्रश्न
Long Answer Question:
Explain the process of DNA replication.
Okasaki fragments are joined together by ______.
Differentiate between Leading stand and lagging strand.
Identify the direction of DNA replication in eukaryotes.
Read the following statements and select the correct option.
Statement I: DNA replication is continuous on leading strand while on the lagging strand it is discontinuous.
Statement II: DNA polymerase cannot initialize polymerization without a primer.
Which of tbe following is generally used for creating density gradient during centrifugation?
When the DNA molecule appears like inverted Y, it is ______
During the replication of DNA, the separated strands are prevented from recoiling by using ______.
Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
