Advertisements
Advertisements
Question
From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability, and mutation?
Advertisements
Solution
Inference of Watson and Crick on DNA replication:
They concluded that each of the DNA strand in a helix act as template during DNA replication leading to formation of new daughter DNA molecules, which are complementary to parental strand, (i.e., Semi-conservative method of replication).
Inference on coding capability:
During transcription, the genetic information in the DNA strand is coded to mRNA as complementary bases, (except for uracil in place of thymine in RNA).
Inference on mutation:
Any changes in the nucleotide sequence of DNA leads to corresponding alteration in aminoacid sequence of specific protein thus confirming the validity of genetic code.
RELATED QUESTIONS
Which of the following statements is not true about DNA replication in eukaryotes?
a) Identify the figure given below
b) Redraw the structure as a replicating fork and label the parts
c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
Complementary strands of DNA molecule are (i) and bound by (ii).
Which of tbe following is generally used for creating density gradient during centrifugation?
In DNA molecule, pairing between two complementary nucleotides takes place by ________ bonds.
When the DNA molecule appears like inverted Y, it is ______
Identify the biomolecule that is capable of self-replication.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
In semi-conservative DNA replication, each daughter DNA molecule contains:
Which of the following is classified as an autocatalytic function of DNA?
