Advertisements
Advertisements
प्रश्न
What background information did Watson and Crick had available with them for developing a model of DNA? What was their own contribution?
Advertisements
उत्तर
Wastson and Crick had the following informations which helped them to develop a model of DNA.
- Chargaffs’ Law suggesting A = T, and C = G.
- Wilkins and Rosalind Franklin’s work on DNA crystal’s X-ray diffraction studies about DNA’s physical structure.
- Watson and crick proposed
- How complementary bases may pair
- Semi-conservative replication and
- Mutation through tautomerism
APPEARS IN
संबंधित प्रश्न
______ enzymes are used as biological scissors in r-DNA technology.
Very Short Answer Question:
When does DNA replication takes place?
How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?
Describe the process of semiconservative replication of DNA with the help of a neat and labelled diagram.
Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.
For which of the following purpose agarose gel electrophoresis technique is used?
During DNA replication, Okazaki fragments are used to elongate ____________.
______ heavy isotope was used by Meselson and Stahl during their experiment.
Which of the following represents the autocatalytic functions of DNA?
Which of the following is present at the sticky ends of a fragmented DNA molecule?
"DNA is considered as genetic material" - Why?
Match the following column.
| Column - I | Column - II |
| (A) DNA structure | 1. Muller and stadder |
| (B) Semiconservative replication of DNA | 2. Beadle and partum |
| (C) One gene-one enzyme theory | 3. Watson and crick |
| (D) Induction of mutation | 4. Massillon and stahl |
During replication of DNA Okazaki fragments are formed in the direction:
Okazaki segments are formed during ______.
Which of the following reaction is required for proofreading during DNA replication by DNA polymerase III?
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Which of the following DNA polymerase enzyme in eukaryotes has 5' -3' exonuclease activity?
Torsional stress created during DNA replication is relieved by ______.
