Advertisements
Advertisements
प्रश्न
How CO2 makes idlies puffy?
Advertisements
उत्तर
In the preparation of idli batter, the batter is fermented using bacteria or yeast. During fermentation, CO2 bubbles which are released get trapped in the gluten, thus making idlis puffy.
APPEARS IN
संबंधित प्रश्न
Explain replication of bacteriophage with the help of a suitable diagram.
Very Short Answer Question:
Why are Okazaki fragments formed on lagging strand only?
Very Short Answer Question:
When does DNA replication takes place?
Okasaki fragments are joined together by ______.
Which of the following represents the autocatalytic functions of DNA?
In which direction polymerization of DNA nucleotides occurs during the synthesis of lagging strand?
For which of the following reason RNA primer is must for initiation of DNA replication?
In the experiment of Meselson and Stahl, the heavy DNA was separated from light DNA by centrifugation in ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Torsional stress created during DNA replication is relieved by ______.
