Advertisements
Advertisements
प्रश्न
How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?
Advertisements
उत्तर
The Meselson and Stahl experiment is as follows:
- They cultured E. coli bacteria in the medium containing 14N (light nitrogen) and obtained an equilibrium density gradient band by using 6M CsCl2. The position of this band was recorded.
- E. coli cells were then transferred to a 15N medium (heavy isotopic nitrogen) and allowed to replicate for several generations. At equilibrium point density gradient band was obtained, by using 6M CsCl2. The position of this band was recorded.
- The heavy DNA (15N) molecule can be distinguished from normal DNA by centrifugation in a 6M Caesium chloride (CsCl2) density gradient. The density gradient value of 6M CsCl2 and 15N DNA is almost the same. Therefore, at the equilibrium point, 15N DNA will form a band. In this, both strands of DNA are labelled with 15N.
- Such E. coli cells were then transferred to another medium containing 14N i.e. normal (light) nitrogen. After the first generation, the density gradient band for 14N 15N was obtained and its position was recorded. After the second generation, two density gradient bands were obtained - one at 14N 15N position and the other at 14N position.
- The position of bands after two generations clearly proved that DNA replication is semiconservative.
संबंधित प्रश्न
How CO2 makes idlies puffy?
Very Short Answer Question:
Why are Okazaki fragments formed on lagging strand only?
A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?
What are Okazaki fragments?
What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?
Which of the following statements is not true about DNA replication in eukaryotes?
a) Identify the figure given below
b) Redraw the structure as a replicating fork and label the parts

c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
For which of the following purpose agarose gel electrophoresis technique is used?
Select the incorrect statement regarding DNA replication.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
