Advertisements
Advertisements
प्रश्न
Enlist the names of enzymes used in semiconservative replication of DNA?
Advertisements
उत्तर
Following are the enzymes required during DNA synthesis:
- Helicase (rep protein)
- RNA primase
- DNA polymerase
- RNase
- DNA ligase
- Gyrase
संबंधित प्रश्न
Explain the semi-conservative replication of eukaryotic DNA.
Semiconservative mechanism of DNA was detected using:
During DNA replication, the separated strands of DNA are prevented from recoiling by
A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?
Which of the following statements about DNA replication is not correct?
Meselson and Stahl’s experiment proved ______.
Which of the following term correctly describes the movement of ribosome on the mRNA?
Wobble position means:
In the experiment of Meselson and Stahl, the heavy DNA was separated from light DNA by centrifugation in ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
