Advertisements
Advertisements
Question
Enlist the names of enzymes used in semiconservative replication of DNA?
Advertisements
Solution
Following are the enzymes required during DNA synthesis:
- Helicase (rep protein)
- RNA primase
- DNA polymerase
- RNase
- DNA ligase
- Gyrase
RELATED QUESTIONS
Meselson and Stahl’s experiment proved ______.
a) Identify the figure given below
b) Redraw the structure as a replicating fork and label the parts
c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
Identify the direction of DNA replication in eukaryotes.
Identify the CORRECT combination of statements with respect to DNA synthesis.
I. Always the direction of DNA polymerization 5' → 3' when referring to the polarity of strand being synthesized.
II. DNA ligase forms hydrogen bonds between two newly synthesized DNA strands.
III. DNA polymerases on their own cannot initiate the process of replication.
IV. DNA polymerase can catalyse polymerization in both 5'→ 3' and 3'→ 5' direction.
Which of tbe following is generally used for creating density gradient during centrifugation?
Nucleolus is a major center for:
Wobble position means:
In viral DNA, how many origins of replication is/are present?
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?
