Advertisements
Advertisements
प्रश्न
Enlist the names of enzymes used in semiconservative replication of DNA?
Advertisements
उत्तर
Following are the enzymes required during DNA synthesis:
- Helicase (rep protein)
- RNA primase
- DNA polymerase
- RNase
- DNA ligase
- Gyrase
संबंधित प्रश्न
How CO2 makes idlies puffy?
What is the function of an RNA primer during protein synthesis?
Identify the direction of DNA replication in eukaryotes.
Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.
Match Column I with Column II and select the correct option among the following.
| Column I | Column II | ||
| i. | DNA replication | a. | RNA polymerase |
| ii. | Translation | b. | DNA polymerase |
| iii. | Transcription | c. | Reverse transcriptase |
| iv. | Reverse transcription | d. | t-RNA- amino acid complex |
______ heavy isotope was used by Meselson and Stahl during their experiment.
When DNA directs the synthesis of chemical molecules other than itself, then such functions of DNA are known as ______.
In a segment of DNA with 10 base pairs, the numbers of sugar molecules are _________.
In viral DNA, how many origins of replication is/are present?
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
