Advertisements
Advertisements
प्रश्न
Enlist the names of enzymes used in semiconservative replication of DNA?
Advertisements
उत्तर
Following are the enzymes required during DNA synthesis:
- Helicase (rep protein)
- RNA primase
- DNA polymerase
- RNase
- DNA ligase
- Gyrase
संबंधित प्रश्न
What is the correct sequence of the stages in bacteriophage lytic cycle?
(A) Attachment, Penetration, Lysis, Multiplication
(B) Attachment, Penetration, Multiplication, Lysis
(C) Lysis, Penetration, Multiplication, Attachment
(D) Attachment, Lysis, Multiplication, Penetration
Semiconservative mechanism of DNA was detected using:
Describe the process of semiconservative replication of DNA with the help of a neat and labelled diagram.
What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?
Identify the direction of DNA replication in eukaryotes.
Assertion (A): DNA replication is said to be semi-conservative.
Reason (R): After DNA replication, each daughter molecule has one old and one new strand.
Which of tbe following is generally used for creating density gradient during centrifugation?
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Which of the following DNA polymerase enzyme in eukaryotes has 5' -3' exonuclease activity?
Torsional stress created during DNA replication is relieved by ______.
