English

Differentiate between Leading stand and lagging strand. - Biology (Theory)

Advertisements
Advertisements

Question

Differentiate between Leading stand and lagging strand.

Distinguish Between
Advertisements

Solution

Feature Leading Strand Lagging Strand
1. Direction of synthesis Synthesized continuously in the same direction as the replication fork. Synthesized discontinuously in the opposite direction of the replication fork.
2. Formation Formed as a single, continuous strand. Formed in short fragments called Okazaki fragments.
3. Requirement of primers Requires only one RNA primer to start synthesis. Requires multiple RNA primers, one for each Okazaki fragment.
4. DNA polymerase movement Moves toward the replication fork. Moves away from the replication fork.
5. Speed of synthesis Faster because it is continuous. Slower because it is discontinuous.
shaalaa.com
  Is there an error in this question or solution?
Chapter 5: Molecular Genetics - Evaluation [Page 85]

APPEARS IN

Samacheer Kalvi Biology (Zoology) [English] Class 12 TN Board
Chapter 5 Molecular Genetics
Evaluation | Q 17. | Page 85
Samacheer Kalvi Biology (Zoology) [English] Class 12 TN Board
Chapter 5 Molecular Genetics
Evaluation | Q 17. | Page 88
Nootan Biology [English] Class 12 ISC
Chapter 6 Molecular Basis of Inheritance
DIFFERENTIATE BETWEEN | Q 5. | Page 279

RELATED QUESTIONS

Explain the semi-conservative replication of eukaryotic DNA.


A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?


What is the function of SSBP?


Okasaki fragments are joined together by ______.


Which of the following statements about DNA replication is not correct?


Meselson and Stahl’s experiment proved ______.


Match Column I with Column II and select the correct option among the following.

  Column I   Column II
i. DNA replication a. RNA polymerase
ii. Translation b. DNA polymerase
iii. Transcription c. Reverse transcriptase
iv. Reverse transcription d. t-RNA- amino acid complex

For which of the following purpose agarose gel electrophoresis technique is used?


E. coli, in which both the strands of DNA are labeled with 15N is transferred to 14N medium and allowed to replicate for three generations. What would be the number of hybrid DNA molecules in the third generation?


Which one of the following correctly represents the manner of replication of DNA?


Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?


Assertion (A): DNA replication is said to be semi-conservative.

Reason (R): After DNA replication, each daughter molecule has one old and one new strand.


Which of the following is the function of single-strand binding proteins?


______ carbon atoms of successive nucleotides of nucleic acid are linked by Phospho-diester bond.


Extension of the plasma membrane in a prokaryotic cell is ______.


Which of the following reaction is required for proofreading during DNA replication by DNA polymerase III?


Select the incorrect statement regarding DNA replication.


How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'


The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×